Solitary extramedullary plasmacytoma of the nasopharynx: The role of flow cytometry

Solitary extramedullary plasmacytoma of the nasopharynx: The role of flow cytometry

Extramedullary plasmacytoma (EMP) represents a definite but uncommon entity among the many plasma cell neoplasms. Given its rarity, no therapeutic consensus has been met. We report the case of a 57-year-old man with a one-year historical past of nasal congestion and occasional dyspnoea. Imaging confirmed a hypermetabolic mass in the proper nasopharynx extending backward in the direction of the adjoining oropharynx, infiltrating the epiglottis. As incisional biopsy confirmed histologic and immunophenotypic options in step with plasma cell neoplasm, whereas the potential of a marginal zone lymphoma with plasmacytic differentiation was included within the differential analysis.

A ultimate analysis of EMP was reached by utilizing circulation cytometry (FC) of a cell suspension from the neoplastic tissue. The affected person obtained native radiotherapy (RT) which resulted to finish remission. In conclusion, circulation cytometry would possibly function an auxiliary methodology in circumstances the place immunohistochemistry can’t differentiate between a plasma cell dyscrasia and a B-non-Hodgkin lymphoma. In circumstances of a longtime analysis of solitary nasopharyngeal EMP RT represents a wonderful therapy modality providing extended disease-free survival.

Though circulation cytometry and cell sorting are broadly utilized by immunologists each for fundamental and translation analysis, many facets of those methods needs to be optimized to acquire reproducible and significant knowledge. On this chapter we offer some protocols and recommendations on instrument setting, multicolor panel design and T-cell immunophenotyping and proliferation assay.

Multiparametric circulation cytometry is a extremely delicate methodology to determine and quantify malignant PCs. And the ratio of malignant PCs detected by MFC confirmed strongly correlation with the severity of the pathology of MM. Malignant PCs in BM detected by circulation cytometry might be thought to be a predictor for the danger stratification system of MM. Thus, it needs to be thought-about making use of within the routine analysis of MM at analysis and after remedy.

Strategies for Characterization of Senescent Circulating and Tumor-Infiltrating T-Cells: An Overview from Multicolor Movement Cytometry to Single-Cell RNA Sequencing

Immunosenescence is the final time period used to explain the aging-associated decline of immunological operate that explains the upper susceptibility to infectious illnesses and most cancers, elevated autoimmunity, or the decreased effectiveness of vaccinations. Senescence of CD8+ T-cells has been described in all these circumstances.An important classical markers of T senescent cells are the cell cycle inhibitors p16ink4a, p21, and p53, along with positivity for SA-βgal expression and the acquirement of a peculiar IFNγ -based secretory phenotype generally outlined SASP (Senescence Related Secretory Phenotype).

Different floor markers are the CD28 and CD27 loss along with acquire of expression of CD45RA, CD57, TIGIT, and/or KLRG1. Nonetheless, this characterization couldn’t be ample to tell apart from actually senescent cells and exhausted T-cells. Moreover, extra complexity is added by the large heterogeneity of T-cells subset in aged people or within the tumor microenvironment. A mixed evaluation by multicolor circulation cytometry for floor and intracellular markers built-in with gene-expression arrays and single-cell RNA sequencing is required to develop efficient interventions for therapeutic modulation of particular T-cell subsets.

The RNASeq presents the good chance to disclose at single-cell decision the precise molecular hallmarks of senescent CD8+ T-cells with out the constraints of bulk evaluation. Moreover, the great integration of multidimensional approaches (genomics, epigenomics, proteomics, metabolomics) will enhance our world understanding of how immunosenescence of T-cells is interlinked to human ageing.

In Vivo Movement Cytometry

In vivo circulation cytometry (IVFC) was first designed to detect circulating cells in a mouse ear. It permits real-time monitoring of cells in peripheral blood without having to attract blood. The IVFC discipline has made nice progress over the past decade with the event of fluorescence, photoacoustic, and multiphoton microscopy. Furthermore, the appliance of IVFC is not restricted to circulating cells. IVFC based mostly on fluorescence and photoacoustic are most generally utilized in biomedical analysis. Strategies based mostly on fluorescence are sometimes used for object monitoring in superficial vessels, whereas strategies based mostly on photoacoustics have a bonus of label-free monitoring in deep vessels. On this chapter, we introduce technical factors and key purposes of IVFC.

Solitary extramedullary plasmacytoma of the nasopharynx: The role of flow cytometry

We concentrate on the ideas, labeling methods, sensitivity, and biomedical purposes of the know-how. As well as, we summarize this chapter and focus on essential analysis instructions of IVFC sooner or later. This can be a cross-sectional, case-control examine together with 60 sufferers with systemic lupus erythematosus and 20 sex- and age-matched wholesome controls. A 14-color immunophenotyping panel was utilized to detect proportions of circulating immune mononuclear cells, and comparisons between sufferers and wholesome controls, and subgroups of sufferers, had been carried out. Correlations between mobile proportions and different parameters had been investigated.

On-chip imaging circulation cytometry has been broadly utilized in most cancers biology, immunology, microbiology, and drug discovery. Pure optical imaging mixed with circulation cytometry to derive chemical, structural, and morphological options of cells supplies systematic insights into organic processes. Nonetheless, as a result of excessive focus and powerful optical attenuation of purple blood cells, preprocessing is important for optical circulation cytometry whereas coping with entire blood.

Anti-LAMP3 antibody (Alexa-fluor 546)

STJ170005 100 µg
EUR 393
Description: The dendritic cell lysosomal-associated membrane protein (DC-LAMP)/CD208 is a type I integral transmembrane glycoprotein mostly homologous to CD68, of about 45 kDa in mouse and 90 kDa in human (glycosylation), with a bipartite C-terminal structure divided by a serine/proline rich region, a transmembrane domain and a conserved tyrosine-based lysosomal targeting motif in its cytoplasmic tail. Initially cloned as a specific marker of human mature dendritic cells (DCs), DC-LAMP has been subsequently shown to be expressed in alveolar type II pneumocytes. In both cell types, the molecule is found in the limiting membrane of intracellular multi-lamellar bodies, known as MIIC (MHC class II compartments) in human mature DCs and as lung surfactant-containing lamellar bodies in type II pneumocytes. In the latter cell type, DC-LAMP expression is also detected at the cell surface.

Anti-LAMP3 antibody (Alexa-fluor 647)

STJ170006 100 µg
EUR 393
Description: The dendritic cell lysosomal-associated membrane protein (DC-LAMP)/CD208 is a type I integral transmembrane glycoprotein mostly homologous to CD68, of about 45 kDa in mouse and 90 kDa in human (glycosylation), with a bipartite C-terminal structure divided by a serine/proline rich region, a transmembrane domain and a conserved tyrosine-based lysosomal targeting motif in its cytoplasmic tail. Initially cloned as a specific marker of human mature dendritic cells (DCs), DC-LAMP has been subsequently shown to be expressed in alveolar type II pneumocytes. In both cell types, the molecule is found in the limiting membrane of intracellular multi-lamellar bodies, known as MIIC (MHC class II compartments) in human mature DCs and as lung surfactant-containing lamellar bodies in type II pneumocytes. In the latter cell type, DC-LAMP expression is also detected at the cell surface.

Anti-IL3RA antibody (Alexa-fluor 488)

STJ170009 100 µg
EUR 393
Description: IL3 exerts its biologic activity through its interaction with a cell surface receptor that consists of two subunits. The a subunit (CD123) specifically binds IL3, whereas the ß subunit is required for signaling and is common to the GMCSFR and IL5-R. 107D2.08 and 106C2.02 mAbs were obtained after mouse immunization with sorted human tonsillar PDC. Both clones strongly stain PDCs and basophils, weakly stain monocytes, CD34+ derived DCs and CD11c+ DC, while no staining is observed on T, B, NK cells as well as on mono-derived DCs. Staining with 107D2.08 and 106C2.02 mAbs are maintained on sorted PDC cultured in the presence of IL3 and CD40L, but lost when IL3 alone is added to the culture. The recognition of the IL3Ra chain by 107D2.08 and 106C2.02 was confirmed by transfection studies. 107D2.08 appeared to be the most appropriate clone for in situ studies. 107D2.08 allowed the first observation of IL3Ra+ cells in breast tumor microenvironment

Anti-IL3RA antibody (Alexa-fluor 546)

STJ170010 100 µg
EUR 393
Description: IL3 exerts its biologic activity through its interaction with a cell surface receptor that consists of two subunits. The a subunit (CD123) specifically binds IL3, whereas the ß subunit is required for signaling and is common to the GMCSFR and IL5-R. 107D2.08 and 106C2.02 mAbs were obtained after mouse immunization with sorted human tonsillar PDC. Both clones strongly stain PDCs and basophils, weakly stain monocytes, CD34+ derived DCs and CD11c+ DC, while no staining is observed on T, B, NK cells as well as on mono-derived DCs. Staining with 107D2.08 and 106C2.02 mAbs are maintained on sorted PDC cultured in the presence of IL3 and CD40L, but lost when IL3 alone is added to the culture. The recognition of the IL3Ra chain by 107D2.08 and 106C2.02 was confirmed by transfection studies. 107D2.08 appeared to be the most appropriate clone for in situ studies. 107D2.08 allowed the first observation of IL3Ra+ cells in breast tumor microenvironment

Anti-IL3RA antibody (Alexa-fluor 647)

STJ170011 100 µg
EUR 393
Description: IL3 exerts its biologic activity through its interaction with a cell surface receptor that consists of two subunits. The a subunit (CD123) specifically binds IL3, whereas the ß subunit is required for signaling and is common to the GMCSFR and IL5-R. 107D2.08 and 106C2.02 mAbs were obtained after mouse immunization with sorted human tonsillar PDC. Both clones strongly stain PDCs and basophils, weakly stain monocytes, CD34+ derived DCs and CD11c+ DC, while no staining is observed on T, B, NK cells as well as on mono-derived DCs. Staining with 107D2.08 and 106C2.02 mAbs are maintained on sorted PDC cultured in the presence of IL3 and CD40L, but lost when IL3 alone is added to the culture. The recognition of the IL3Ra chain by 107D2.08 and 106C2.02 was confirmed by transfection studies. 107D2.08 appeared to be the most appropriate clone for in situ studies. 107D2.08 allowed the first observation of IL3Ra+ cells in breast tumor microenvironment

Anti-CD207 antibody (Alexa-fluor 488)

STJ170014 100 µg
EUR 393
Description: Langerin/CD207 is a transmembrane C-type lectin receptor (CLR) of epidermal and mucosal Langerhans cells (LCs) that induces Birbeck's granule formation. Langerin features a single carbohydrate recognition domain (CRD) with mannose-type specificity in its extracellular portion. Langerin is unique among the CLRs in that it contains an intracellular domain with a proline-rich motif. Langerin expression has not been reported outside the DC system. (Valladeau J et al, 1999, Eur.J.Immunol., 29:2695-2704; Valladeau J et al, 2000 Immunity, 12 : 71-81; Kashihara M et al, 1986, J.Invest.Derm., 87 :602-607 Ito T et al, 1999, J.Immunol., 163 :1409-1419 ;Saeland S & Valladeau J, CD207 (Langerin) Workshop reports 2002, Leukocyte-Typing VII, White Cell Diff Antigens, D. Mason et al, Eds, Oxford University Press:306-307)

Anti-CD207 antibody (Alexa-fluor 546)

STJ170015 100 µg
EUR 393
Description: Langerin/CD207 is a transmembrane C-type lectin receptor (CLR) of epidermal and mucosal Langerhans cells (LCs) that induces Birbeck's granule formation. Langerin features a single carbohydrate recognition domain (CRD) with mannose-type specificity in its extracellular portion. Langerin is unique among the CLRs in that it contains an intracellular domain with a proline-rich motif. Langerin expression has not been reported outside the DC system. (Valladeau J et al, 1999, Eur.J.Immunol., 29:2695-2704; Valladeau J et al, 2000 Immunity, 12 : 71-81; Kashihara M et al, 1986, J.Invest.Derm., 87 :602-607 Ito T et al, 1999, J.Immunol., 163 :1409-1419 ;Saeland S & Valladeau J, CD207 (Langerin) Workshop reports 2002, Leukocyte-Typing VII, White Cell Diff Antigens, D. Mason et al, Eds, Oxford University Press:306-307)

Anti-CD207 antibody (Alexa-fluor 647)

STJ170016 100 µg
EUR 393
Description: Langerin/CD207 is a transmembrane C-type lectin receptor (CLR) of epidermal and mucosal Langerhans cells (LCs) that induces Birbeck's granule formation. Langerin features a single carbohydrate recognition domain (CRD) with mannose-type specificity in its extracellular portion. Langerin is unique among the CLRs in that it contains an intracellular domain with a proline-rich motif. Langerin expression has not been reported outside the DC system. (Valladeau J et al, 1999, Eur.J.Immunol., 29:2695-2704; Valladeau J et al, 2000 Immunity, 12 : 71-81; Kashihara M et al, 1986, J.Invest.Derm., 87 :602-607 Ito T et al, 1999, J.Immunol., 163 :1409-1419 ;Saeland S & Valladeau J, CD207 (Langerin) Workshop reports 2002, Leukocyte-Typing VII, White Cell Diff Antigens, D. Mason et al, Eds, Oxford University Press:306-307)

Anti-IL7R antibody (Alexa-fluor 488)

STJ170020 100 µg
EUR 393
Description: The IL7-R consists of 2 chains, IL-7R known as CD127 and common cytokine receptor chain known as CD132. A 75 to 80kDa human IL-7 receptor has been cloned that belongs to hematopoietic cytokinereceptor super family. R34-34, raised against human leukemic pre-B cells, recognized a molecule expressed on normal B cell precursors but not on mature B cells. This antibody specifically reverted IL-7 mediated growth inhibition of leukemic BCP (normal B cells precursors) and mature T cells. IL-7R expression is dramatically influenced by cytokines and antigens. This IL-7R displays both high and low affinity for its ligand (IL-7). Inhibitory and proliferative effects of IL-7 can be mediated through the same receptor on various lineages. CD4+ memory T cells express high level of IL-7R Subsets that express it generally require it, including progenitors of T and B cells, naïve and memory T cells. (Pandrau-Garcia D et al, 1994, Blood, 83, 3613-9 Mazzucchelli R et al, Nat. Review Immunol., 2007,7, 144-54)

Anti-IL7R antibody (Alexa-fluor 546)

STJ170021 100 µg
EUR 393
Description: The IL7-R consists of 2 chains, IL-7R known as CD127 and common cytokine receptor chain known as CD132. A 75 to 80kDa human IL-7 receptor has been cloned that belongs to hematopoietic cytokinereceptor super family. R34-34, raised against human leukemic pre-B cells, recognized a molecule expressed on normal B cell precursors but not on mature B cells. This antibody specifically reverted IL-7 mediated growth inhibition of leukemic BCP (normal B cells precursors) and mature T cells. IL-7R expression is dramatically influenced by cytokines and antigens. This IL-7R displays both high and low affinity for its ligand (IL-7). Inhibitory and proliferative effects of IL-7 can be mediated through the same receptor on various lineages. CD4+ memory T cells express high level of IL-7R Subsets that express it generally require it, including progenitors of T and B cells, naïve and memory T cells. (Pandrau-Garcia D et al, 1994, Blood, 83, 3613-9 Mazzucchelli R et al, Nat. Review Immunol., 2007,7, 144-54)

Anti-IL7R antibody (Alexa-fluor 647)

STJ170022 100 µg
EUR 393
Description: The IL7-R consists of 2 chains, IL-7R known as CD127 and common cytokine receptor chain known as CD132. A 75 to 80kDa human IL-7 receptor has been cloned that belongs to hematopoietic cytokinereceptor super family. R34-34, raised against human leukemic pre-B cells, recognized a molecule expressed on normal B cell precursors but not on mature B cells. This antibody specifically reverted IL-7 mediated growth inhibition of leukemic BCP (normal B cells precursors) and mature T cells. IL-7R expression is dramatically influenced by cytokines and antigens. This IL-7R displays both high and low affinity for its ligand (IL-7). Inhibitory and proliferative effects of IL-7 can be mediated through the same receptor on various lineages. CD4+ memory T cells express high level of IL-7R Subsets that express it generally require it, including progenitors of T and B cells, naïve and memory T cells. (Pandrau-Garcia D et al, 1994, Blood, 83, 3613-9 Mazzucchelli R et al, Nat. Review Immunol., 2007,7, 144-54)

SAM FCM (Alexa Fluor 647)

abx098902-100tests 100 tests
EUR 1233
  • Shipped within 5-10 working days.

SAM FCM (Alexa Fluor 488)

abx098904-60tests 60 tests
EUR 1358
  • Shipped within 5-10 working days.

Anti-RPSA Alexa Fluor® 488

A4-829-C100 0.1 mg
EUR 310

Goat anti Mouse IgG1 (Alexa Fluor 488)

43R-1649 500 ug
EUR 570
Description: Goat anti Mouse IgG1 secondary antibody (Alexa Fluor 488)

Anti-Hu CD16 Alexa Fluor® 488

A4-646-T100 100 tests
EUR 269

Alpha Fluor™ 532 acid [equivalent to Alexa Fluor™ 532 acid]

1795 10 mg
EUR 393
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Mouse IgG1-Alexa 555 conjugate (isotype control)

20102-101-A555 50 Tests
EUR 263

AF350 Phalloidin [equivalent to Alexa Fluor® 350 phalloidin]

23150 300 Tests
EUR 306
  • R-phrase: R23, R24, R25
  • H-Phrase: H301, H311, H331
  • Symbol for dangerous compounds: T
  • UNSPEC Code: 12352200

AF488 Phalloidin [equivalent to Alexa Fluor® 488 phalloidin]

23153 300 Tests
EUR 306
  • R-phrase: R23, R24, R25
  • H-Phrase: H301, H311, H331
  • Symbol for dangerous compounds: T
  • UNSPEC Code: 12352200

AF594 Phalloidin [equivalent to Alexa Fluor® 594 phalloidin]

23158 300 Tests
EUR 306
  • R-phrase: R23, R24, R25
  • H-Phrase: H301, H311, H331
  • Symbol for dangerous compounds: T
  • UNSPEC Code: 12352200

AF350-streptavidin conjugate [Streptavidin, Alexa Fluor™ 350 Conjugate]

16890 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

AF488-streptavidin conjugate [Streptavidin, Alexa Fluor™ 488 Conjugate]

16891 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

AF594-streptavidin conjugate [Streptavidin, Alexa Fluor™ 594 Conjugate]

16892 1 mg
EUR 176
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Donkey anti Goat IgG (H + L) (Alexa Fluor 594)

43R-ID005AF 500 ug
EUR 338
Description: Donkey anti Goat IgG (H + L) secondary antibody (Alexa Fluor 594)

Donkey anti Rat IgG (H + L) (Alexa Fluor 594)

43R-ID022AF 500 ug
EUR 364
Description: Donkey anti Rat IgG (H + L) secondary antibody (Alexa Fluor 594)

Donkey anti Goat IgG (H + L) (Alexa Fluor 647)

43R-ID028AF 500 ug
EUR 430
Description: Donkey anti Goat IgG (H + L) secondary antibody (Alexa Fluor 647)

Donkey anti Rat IgG (H + L) (Alexa Fluor 594)

43R-ID047AF 500 ug
EUR 462
Description: Donkey anti Rat IgG (H + L) secondary antibody (Alexa Fluor 594)

Donkey anti Chicken IgY (H + L) (Alexa Fluor 594)

43R-ID056AF 500 ug
EUR 343
Description: Donkey anti Chicken IgY secondary antibody (H + L) (Alexa Fluor 594)

Donkey anti Chicken IgY (H + L) (Alexa Fluor 647)

43R-ID060AF 300 ug
EUR 425
Description: Donkey anti Chicken IgY (H + L) (Fab'2) (Alexa Fluor 647)

Rabbit anti Chicken IgY (H + L) (Alexa Fluor 594)

43R-IR016AF 1 mg
EUR 281
Description: Rabbit anti Chicken IgY (H + L) secondary antibody (Alexa Fluor 594)

Anti-Hu CD72 Alexa Fluor® 488

A4-310-T100 100 tests
EUR 269

Anti-Bov CD9 Alexa Fluor® 488

A4-354-C100 0.1 mg
EUR 269

Anti-Hu CD30 Alexa Fluor® 700

A7-455-T100 100 tests
EUR 269

Anti-Hu CD94 Alexa Fluor® 700

A7-727-T100 100 tests
EUR 269

Anti-Hu CD56 Alexa Fluor® 700

A7-789-T100 100 tests
EUR 269

SDCCAG8 antibody

70R-20131 50 ul
EUR 435
Description: Rabbit polyclonal SDCCAG8 antibody

SDCCAG8 Antibody

43294-100ul 100ul
EUR 252

SDCCAG8 Antibody

DF8846 200ul
EUR 304
Description: SDCCAG8 Antibody detects endogenous levels of total SDCCAG8.

SDCCAG8 Antibody

1-CSB-PA006722
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SDCCAG8. Recognizes SDCCAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

SDCCAG8 antibody

70R-4002 50 ug
EUR 467
Description: Rabbit polyclonal SDCCAG8 antibody raised against the N terminal of SDCCAG8

SDCCAG8 antibody

70R-4128 50 ug
EUR 467
Description: Rabbit polyclonal SDCCAG8 antibody raised against the middle region of SDCCAG8

SDCCAG8 Antibody

1-CSB-PA020899GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SDCCAG8. Recognizes SDCCAG8 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

SDCCAG8 Antibody

ABD8846 100 ug
EUR 438

Goat Anti-Mouse IgG(H+L) Alexa Fluor 594–conjugated

S0005 200ul
EUR 376

Goat Anti-Rabbit IgG(H+L) Alexa Fluor 594–conjugated

S0006 200ul
EUR 376

Goat Anti-Rabbit IgG(H+L) Alexa Fluor 647–conjugated

S0013 200ul
EUR 304

Goat Anti-Mouse IgG(H+L) Alexa Fluor 647–conjugated

S0014 200ul
EUR 304

Goat Anti-Mouse IgG(H+L) Alexa Fluor 488–conjugated

S0017 200ul
EUR 304

Goat Anti-Rabbit IgG(H+L) Alexa Fluor 488–conjugated

S0018 200ul
EUR 304

Anti-LAMP3 (human) Monoclonal Antibody (104G4) (Alexa Fluor® 488)

M09406 100ug
EUR 565
Description: Mouse Monoclonal LAMP3 (human) Antibody (104G4) (Alexa Fluor® 488). Validated in IHC and tested in Human.

SDCCAG8 Conjugated Antibody

C43294 100ul
EUR 397

anti- SDCCAG8 antibody

FNab07666 100µg
EUR 505.25
  • Immunogen: serologically defined colon cancer antigen 8
  • Uniprot ID: Q86SQ7
  • Gene ID: 10806
  • Research Area: Metabolism
Description: Antibody raised against SDCCAG8

Anti-SDCCAG8 antibody

PAab07666 100 ug
EUR 355

Anti-SDCCAG8 antibody

STJ72779 100 µg
EUR 359

Donkey anti Goat IgG (H + L) (Fab 2) (Alexa Fluor 594)

43R-ID012AF 300 ug
EUR 410
Description: Donkey anti Goat IgG (H + L) secondary antibody (Fab'2) (Alexa Fluor 594)

Donkey Anti-Goat IgG (H+L), Alexa Fluor® 594 Conjugated

Ab8011-001 1mg
EUR 334

Donkey Anti-Rabbit IgG (H+L), Alexa Fluor® 488 Conjugated

Ab8032-001 0.5mg
EUR 435

Anti-Hu CD3 zeta (pY153) Alexa Fluor® 488

A4-686-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY72) Alexa Fluor® 488

A4-712-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY142) Alexa Fluor® 488

A4-730-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY111) Alexa Fluor® 488

A4-737-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY153) Alexa Fluor® 647

A6-686-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY72) Alexa Fluor® 647

A6-712-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY142) Alexa Fluor® 647

A6-730-C100 0.1 mg
EUR 269

Anti-Hu CD3 zeta (pY111) Alexa Fluor® 647

A6-737-C100 0.1 mg
EUR 269

Anti-Langerin (human) Monoclonal Antibody (DCGM4/122D5) (Alexa Fluor® 488)

M02316 100ug
EUR 580
Description: Mouse Monoclonal Langerin (human) Antibody (DCGM4/122D5) (Alexa Fluor® 488). Validated in IHC and tested in Human.

SDCCAG8 siRNA

20-abx932704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDCCAG8 siRNA

20-abx932705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SDCCAG8

YF-PA17224 50 ul
EUR 363
Description: Mouse polyclonal to SDCCAG8

anti-SDCCAG8

YF-PA17225 50 ug
EUR 363
Description: Mouse polyclonal to SDCCAG8

Polyclonal SDCCAG8 Antibody (Internal)

APG01216G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (Internal). This antibody is tested and proven to work in the following applications:

SDCCAG8 Blocking Peptide

33R-3716 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDCCAG8 antibody, catalog no. 70R-4002

SDCCAG8 Blocking Peptide

33R-4109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDCCAG8 antibody, catalog no. 70R-4128

SDCCAG8 Blocking Peptide

DF8846-BP 1mg
EUR 195

SDCCAG8 Blocking Peptide

20-abx161437
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SDCCAG8 cloning plasmid

CSB-CL020899HU-10ug 10ug
EUR 413
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atggcgaagtccccggagaactctaccctggaggagattctggggcagtatcaacggagtctccgggaacatgccagcagaagcattcaccaactgacatgtgccctgaaagaaggcgatgtcactattggagaagatgcaccaaatctttcttttagcaccagtgtgggaaatg
  • Show more
Description: A cloning plasmid for the SDCCAG8 gene.

Rabbit Anti-Rat IgG (H+L)-Alexa 488 Fluor conjugate (adsorbed with human IgG)

50336 0.5 ml
EUR 225

Rabbit Anti-Rat IgG (H+L)-Alexa 594 Fluor conjugate (adsorbed with human IgG)

50337 0.5 ml
EUR 225

Polyclonal SDCCAG8 Antibody (internal region)

APG00810G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal SDCCAG8 Antibody (aa469-483)

APG01240G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (aa469-483). This antibody is tested and proven to work in the following applications:

Anti-SDCCAG8 (aa469-483) antibody

STJ72780 100 µg
EUR 359

Mouse Sdccag8 ELISA KIT

ELI-13424m 96 Tests
EUR 865

Human SDCCAG8 ELISA KIT

ELI-29645h 96 Tests
EUR 824

SDCCAG8 ELISA KIT|Human

EF002773 96 Tests
EUR 689

Mouse SDCCAG8 shRNA Plasmid

20-abx978693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SDCCAG8 shRNA Plasmid

20-abx957365
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-SDCCAG8 Plasmid

PVT16613 2 ug
EUR 325

SDCCAG8 Recombinant Protein (Human)

RP096258 100 ug Ask for price

SDCCAG8 Recombinant Protein (Rat)

RP227798 100 ug Ask for price

SDCCAG8 Recombinant Protein (Mouse)

RP170432 100 ug Ask for price

AG 555

B6377-10 10 mg
EUR 144
Description: AG 555 is a potent and selective inhibitor of EGFR with IC50 value of 0.7 ?M. The epidermal growth factor receptor (EGFR) is the cell-surface receptor for epidermal growth factor and plays an important role in tumor invasion and cancer cell proliferation.

AG 555

B6377-25 25 mg
EUR 276
Description: AG 555 is a potent and selective inhibitor of EGFR with IC50 value of 0.7 ?M. The epidermal growth factor receptor (EGFR) is the cell-surface receptor for epidermal growth factor and plays an important role in tumor invasion and cancer cell proliferation.

AG 555

B6377-50 50 mg
EUR 447
Description: AG 555 is a potent and selective inhibitor of EGFR with IC50 value of 0.7 ?M. The epidermal growth factor receptor (EGFR) is the cell-surface receptor for epidermal growth factor and plays an important role in tumor invasion and cancer cell proliferation.

MCC-555

C4892-1 1 mg
EUR 158
Description: MCC-555, also known as RWJ-241947, is a novel peroxisome proliferator?activated receptor ? ligand [1]. The PPAR? receptors mainly express in adipose tissue, colon and macrophages involved in regulating fatty acid storage and glucose metabolism.

MCC-555

C4892-10 10 mg
EUR 918
Description: MCC-555, also known as RWJ-241947, is a novel peroxisome proliferator?activated receptor ? ligand [1]. The PPAR? receptors mainly express in adipose tissue, colon and macrophages involved in regulating fatty acid storage and glucose metabolism.

MCC-555

C4892-5 5 mg
EUR 538
Description: MCC-555, also known as RWJ-241947, is a novel peroxisome proliferator?activated receptor ? ligand [1]. The PPAR? receptors mainly express in adipose tissue, colon and macrophages involved in regulating fatty acid storage and glucose metabolism.

AG 555

HY-15336 10mM/1mL
EUR 126

Recombinant (E.Coli, His-tag) HIV-1 pol Integrase

RP-555 10 ug
EUR 164

Polyclonal SDCCAG8 (aa469-483) Antibody (internal region)

APG00811G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (aa469-483) (internal region). This antibody is tested and proven to work in the following applications:

Sdccag8 ORF Vector (Rat) (pORF)

ORF075934 1.0 ug DNA
EUR 506

SDCCAG8 ORF Vector (Human) (pORF)

ORF032087 1.0 ug DNA
EUR 405

Sdccag8 ORF Vector (Mouse) (pORF)

ORF056812 1.0 ug DNA
EUR 506

Alpha Fluor™ 488 amine

1705 1 mg
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Alpha Fluor™ 488 Hydroxylamine

1900 1 mg
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Tide Fluor 2-LL-37

H-8286.0100 0.1mg
EUR 312
Description: Sum Formula: C205H340N60O53+dye

Tide Fluor 2-LL-37

H-8286.0500 0.5mg
EUR 1017
Description: Sum Formula: C205H340N60O53+dye

Anti-Cytokeratins Alexa Fluor488

A4-108-C025 0.025 mg
EUR 175

Anti-Cytokeratins Alexa Fluor488

A4-108-C100 0.1 mg
EUR 310

Anti-PSMA Alexa Fluor488

A4-539-C025 0.025 mg
EUR 227

Anti-PSMA Alexa Fluor488

A4-539-C100 0.1 mg
EUR 414

Anti-FoxP3 Alexa Fluor488

A4-601-C025 0.025 mg
EUR 201

Anti-FoxP3 Alexa Fluor488

A4-601-C100 0.1 mg
EUR 362

Anti-Phosphotyrosine Alexa Fluor647

A6-263-C025 0.025 mg
EUR 154

Anti-Phosphotyrosine Alexa Fluor647

A6-263-C100 0.1 mg
EUR 269

Anti-LCK Alexa Fluor647

A6-269-C025 0.025 mg
EUR 206

Anti-LCK Alexa Fluor647

A6-269-C100 0.1 mg
EUR 373

Anti-FoxP3 Alexa Fluor647

A6-601-C025 0.025 mg
EUR 201

Anti-FoxP3 Alexa Fluor647

A6-601-C100 0.1 mg
EUR 362

CellBrite Fix 555

30088 1KIT
EUR 563
Description: Minimum order quantity: 1 unit of 1KIT

Cyanine 555 aminooxy

96009 1MG
EUR 342
Description: Minimum order quantity: 1 unit of 1MG

Cyanine 555 tyramide

96020 0.5mg
EUR 353
Description: Minimum order quantity: 1 unit of 0.5mg

Cyanine 555 alkyne

92100 1MG
EUR 226
Description: Minimum order quantity: 1 unit of 1MG

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

20-abx115458
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

20-abx121727
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx029545-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx029545-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx237666-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

20-abx325189
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx432203-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx432204-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Monoclonal Anti-Monkey IgG-Alexa 555 Conj. (specific for monkey; no reactivity with human or animals IgG)

70030-AF555 50 tests
EUR 347

Sdccag8 sgRNA CRISPR Lentivector set (Rat)

K7466701 3 x 1.0 ug
EUR 339

Sdccag8 sgRNA CRISPR Lentivector set (Mouse)

K3434501 3 x 1.0 ug
EUR 339

SDCCAG8 sgRNA CRISPR Lentivector set (Human)

K2108401 3 x 1.0 ug
EUR 339

Zinc Finger Protein 555 (ZNF555) Antibody

abx027298-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Zinc Finger Protein 555 (ZNF555) Antibody

abx027298-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Zinc Finger Protein 555 (ZNF555) Antibody

abx036594-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger Protein 555 (ZNF555) Antibody

20-abx318553
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Aconitase 2 (aa541-555) antibody

STJ72159 100 µg
EUR 359

Metal Fluor™ Zn-520, AM

21263 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Alpha Fluor™ 488 NHS Ester

1812 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Alpha Fluor™ 532 NHS Ester

1819 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Alpha Fluor™ 594 C5 Maleimide

1891 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

On this examine, we develop an on-chip photoacoustic imaging circulation cytometry (PAIFC), which mixes multicolor high-speed photoacoustic microscopy and microfluidics for cell imaging. The machine employs a micro-optical scanner to realize a miniaturized outer dimension of 30 × 17 × 24 mm3 and ultrafast cross-sectional imaging at a body price of 1758 Hz and supplies lateral and axial resolutions of two.2 and 33 μm, respectively.

Leave a Reply

Your email address will not be published. Required fields are marked *