Limitations of VS38c labeling in the detection of plasma cell myeloma by flow cytometry

Limitations of VS38c labeling in the detection of plasma cell myeloma by flow cytometry

Plasma cell myeloma (a number of myeloma [MM]) is a malignant neoplasm originating from the plasma cells. Apart from different strategies, circulation cytometric evaluation of the affected person’s bone marrow aspirate has an vital function within the prognosis and in addition within the response evaluation. Because the cell floor markers, used for figuring out irregular plasma cells, are expressed diversely and the remedy also can alter the phenotype of the plasma cells, there may be an rising demand for brand spanking new plasma cell markers. VS38c is a monoclonal antibody that acknowledges the CLIMP-63 protein within the membrane of the endoplasmic reticulum.

CLIMP-63 is understood to be expressed at excessive ranges in regular and pathologic plasma cells within the bone marrow, thus VS38c antibody can be utilized to determine them. Though VS38c staining of plasma cells is reported to be fixed and robust even in myeloma, we have been questioning whether or not pattern preparation can have an effect on the staining. We’ve investigated the impact of various permeabilization brokers and washing of the cells on the standard of the VS38c staining and located that in lots of circumstances the staining is insufficient to determine the plasma cells.

We measured the VS38c staining of the bone marrow aspirates of 196 MM sufferers and noticed that the majority circumstances confirmed vivid staining with VS38c. Nonetheless, permeabilization with gentle detergent resulted within the look of a big VS38cdim subpopulation, which confirmed elevated sensitivity to mechanical stress (centrifugation). Our outcomes point out that VS38cdim MM cells can seem as a result of improper permeabilization of the endoplasmic reticulum and this discovering raises the opportunity of the existence of a plasma cell subpopulation with totally different membrane properties.

The importance of this inhabitants is unclear but, however these cells could be simply missed with VS38c staining and could be misplaced because of centrifugation-induced lysis throughout pattern preparation. Within the wholesome adults, the reference interval for the neutrophil phagocytosis to Escherichia coli was 46.91%-83.09% and to Staphylococcus aureus was 33.92%-69.48%. This methodology confirmed good reproducibility. Neutrophil phagocytosis was negatively correlated with the neutrophil depend, neutrophil share, and neutrophil-to-lymphocyte ratio

Quantification of Extracellular Double-stranded RNA Uptake and Subcellular Localization Utilizing Stream Cytometry and Confocal Microscopy

Double-stranded RNA is a potent pathogen-associated molecular sample (PAMP) produced as a by-product of viral replication and a well known hallmark of viral an infection. Viral dsRNAs could be launched from contaminated cells into the extracellular house and internalized by neighboring cells by way of endocytosis. Mammals possess a number of sample recognition receptors (PRRs) able to detecting viral dsRNAs reminiscent of endosomal toll-like receptor 3 (TLR3) and cytosolic RIG-I-like receptors (RLRs) which result in the manufacturing of kind I interferons (IFNs). Thus, intracellular localization of viral dsRNA can present perception into the downstream signaling pathways resulting in innate immune activation.

Right here, we describe a quantitative methodology for measuring extracellular dsRNA uptake and visualizing subcellular localization of internalized dsRNA by way of circulation cytometry and confocal microscopy respectively. The protocol described right here has been developed to detect RNA on the single cell degree. Fluorescent probes hybridize to focus on RNAs and are detected by circulation cytometry after a number of amplification steps. Several types of RNA could be detected reminiscent of mRNA, lengthy noncoding RNA, viral RNA or telomere RNA and as much as four totally different goal probes can be utilized concurrently. We used this protocol to particularly measure the expression of two transcription issue mRNAs, MAFB and IRF4, in human monocytes.

Limitations of VS38c labeling in the detection of plasma cell myeloma by flow cytometry

Analysis of measurable residual illness in a number of myeloma by multiparametric circulation cytometry: Present paradigm, pointers, and future purposes

A number of myeloma (MM) is a heterogeneous group of mature B-cell ailments which might be sometimes characterised by the presence and accumulation of irregular plasma cells (PCs), which ends up in the surplus manufacturing of monoclonal immunoglobulin and/or gentle chain discovered within the serum and/or urine. Multiparametric circulation cytometry (MFC) is an indispensable software to complement the prognosis, classification and monitoring of the illness because of its excessive affected person applicability, wonderful sensitivity and inspiring outcomes from numerous scientific trials.

On this regard, minimal or, extra appropriately, measurable residual illness (MRD) negativity by MFC has been acknowledged as a robust predictor of beneficial long-term outcomes. Earlier than circulation cytometry could be successfully carried out within the scientific setting for MM MRD testing, pattern preparation, panel configuration, evaluation and gating methods have to be optimized to make sure correct outcomes. This manuscript will talk about the present consensus pointers for circulation cytometric processing of samples and reporting of outcomes for MM MRD testing.

We additionally talk about various approaches to detect plasma cells within the presence of daratumumab remedy. Lastly, there’s a lack of awareness describing the subclonal distribution of myeloma cells based mostly on their protein expression. The arrival of high-dimensional evaluation might help in following the evolution of antigen expression patterns on irregular plasma cells in sufferers with relapsed/refractory illness. This in flip may also help determine clonal subtypes which might be extra aggressive for potential knowledgeable resolution.

MCCC1 Antibody

47317-100ul 100ul
EUR 252

MCCC1 antibody

70R-18435 50 ul
EUR 435
Description: Rabbit polyclonal MCCC1 antibody

MCCC1 Antibody

1-CSB-PA013572GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MCCC1 Antibody

1-CSB-PA853497EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MCCC1 Antibody

1-CSB-PA853497ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

MCCC1 Antibody

1-CSB-PA853497ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-MCCC1

YF-PA20071 50 ug
EUR 363
Description: Mouse polyclonal to MCCC1

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

MCCC1 Conjugated Antibody

C47317 100ul
EUR 397

anti- MCCC1 antibody

FNab05047 100µg
EUR 548.75
  • Immunogen: methylcrotonoyl-Coenzyme A carboxylase 1(alpha)
  • Uniprot ID: Q96RQ3
  • Gene ID: 56922
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against MCCC1

MCCC1 Rabbit pAb

A10020-100ul 100 ul
EUR 308

MCCC1 Rabbit pAb

A10020-200ul 200 ul
EUR 459

MCCC1 Rabbit pAb

A10020-20ul 20 ul
EUR 183

MCCC1 Rabbit pAb

A10020-50ul 50 ul
EUR 223

MCCC1 cloning plasmid

CSB-CL853497HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2178
  • Sequence: atggcggcggcctctgcggtgtcggtgctgctggtggcggcggagaggaaccggtggcatcgtctcccgagcctgctcctgccgccgaggacatgggtgtggaggcaaagaaccatgaagtacacaacagccacaggaagaaacattaccaaggtcctcattgcaaacagaggag
  • Show more
Description: A cloning plasmid for the MCCC1 gene.

Anti-MCCC1 antibody

PAab05047 100 ug
EUR 386

Anti-MCCC1 antibody

STJ112060 100 µl
EUR 277
Description: This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism.

Anti-MCCC1 (2G8)

YF-MA18990 100 ug
EUR 363
Description: Mouse monoclonal to MCCC1

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

Mouse MCCC1 shRNA Plasmid

20-abx977639
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MCCC1 shRNA Plasmid

20-abx988730
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Mccc1 ELISA KIT

ELI-20526m 96 Tests
EUR 865

MCCC1 ELISA KIT|Human

EF000691 96 Tests
EUR 689

Human MCCC1 ELISA KIT

ELI-39149h 96 Tests
EUR 824

Human MCCC1 shRNA Plasmid

20-abx961224
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCCC1 Antibody, HRP conjugated

1-CSB-PA853497EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MCCC1 Antibody, FITC conjugated

1-CSB-PA853497EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MCCC1 Antibody, Biotin conjugated

1-CSB-PA853497ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCCC1. Recognizes MCCC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MCCC1 Recombinant Protein (Human)

RP018955 100 ug Ask for price

MCCC1 Recombinant Protein (Rat)

RP211094 100 ug Ask for price

MCCC1 Recombinant Protein (Mouse)

RP149786 100 ug Ask for price

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

Green Algae Lysate

PABL-1306 50 ug
EUR 164

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Biolipidure-1002-Reagent

Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

Tri-RNA Reagent

FATRR-001 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 450ml
EUR 645

EL Transfection Reagent

20-abx098880
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Girard's reagent T

20-abx184099
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Convoy? Transfection Reagent

1110-1ml
EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

PureFection Transfection Reagent

LV750A-1 1 ml
EUR 359
  • Category: Lentiviral Technology

LP4K Transfection Reagent

LP4K 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

HighGene transfection reagent

RM09014 1000μl
EUR 270

TissueDigest Reagent, 20X

T101 10ml
EUR 210

ExFect2000 Transfection Reagent

T202-01 0.5 ml
EUR 227

ExFect2000 Transfection Reagent

T202-02 1 ml
EUR 316

ExFect2000 Transfection Reagent

T202-03 5 ml
EUR 1052

Dissociation Reagent, 1ML

X017-1ML 1ML
EUR 109

Dissociation Reagent, 25ML

X017-25ML 25ML
EUR 258

Dissociation Reagent, 5ML

X017-5ML 5ML
EUR 122

Dissociation Reagent, 1ML

X058-1ML 1ML
EUR 73

Dissociation Reagent, 5ML

X058-5ML 5ML
EUR 109

n-Heptane Reagent

HC5400 1L
EUR 79
  • Product category: Biochemicals/Solvents

DTT (Cleland's reagent)

DB0058 5g
EUR 84.8
  • Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)

DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent

EC4600 1L
EUR 79
  • Product category: Biochemicals/Solvents

MCCC1 ORF Vector (Human) (pORF)

ORF006319 1.0 ug DNA
EUR 95

An evaluation utilizing t-SNE to determine the emergence of PCs subclones by MFC, together with the evaluation of their immunophenotypic profiles are offered as a future perspective. Pathogens (Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923) cultured for 18-24 h have been labeled by fluorescence probe carboxyfluorescein diacetate succinimidyl ester (CFDA-SE), after which incubated with complete blood at 37℃. The phagocytosis of pathogens by neutrophils was detected by circulation cytometry, and a reference interval was established.

 

Leave a Reply

Your email address will not be published. Required fields are marked *