Highly sensitive detection of antibody nonspecific interactions using flow cytometry

The quickly evolving nature of antibody drug improvement has resulted in applied sciences that generate huge numbers (a whole bunch to hundreds) of lead antibody candidates throughout early discovery. These candidates have to be quickly pared all the way down to establish probably the most drug-like candidates for in-depth evaluation of their security and efficacy, which may solely be carried out on a restricted variety of antibodies attributable to time and useful resource necessities. One key biophysical property of profitable antibody therapeutics is excessive specificity, outlined as low ranges of nonspecific binding or polyspecificity.

Though there was some progress in creating assays for detecting antibody polyspecificity, most of those assays are restricted by poor sensitivity or assay codecs that require proprietary antibody floor show strategies, and a few of these assays use advanced and poorly outlined polyspecificity reagents. Right here we report the PolySpecificity Particle (PSP) assay, a delicate circulation cytometry assay for evaluating antibody nonspecific interactions that overcomes earlier limitations and can be utilized for evaluating various sorts of IgGs, multispecific antibodies and Fc-fusion proteins. Our strategy makes use of micron-sized magnetic beads coated with Protein A to seize antibodies at extraordinarily dilute concentrations (<0.02 mg/mL).

Move cytometry evaluation of polyspecificity reagent binding to those conjugates ends in delicate detection of variations in nonspecific interactions for clinical-stage antibodies. Our PSP assay strongly discriminates between antibodies with totally different ranges of polyspecificity utilizing beforehand reported polyspecificity reagents which are both well-defined proteins or extremely advanced protein mixtures. Furthermore, we additionally discover {that a} distinctive reagent, particularly ovalbumin, ends in the very best assay sensitivity and specificity. Importantly, our assay is far more delicate than customary assays equivalent to ELISAs. We anticipate that our easy, delicate, and high-throughput PSP assay will speed up the event of protected and efficient antibody therapeutics.

Toxicity of Carbon Nanomaterials-In the direction of Dependable Viability Evaluation by way of New Method in Move Cytometry

The scope of software of carbon nanomaterials in biomedical, environmental and industrial fields is lately considerably growing. Since in vitro toxicity testing is the primary important step for any business utilization, it’s essential to have a dependable methodology to investigate the possibly dangerous results of carbon nanomaterials. Regardless that researchers already reported the interference of carbon nanomaterials with widespread toxicity assays, there’s nonetheless, sadly, a lot of research that neglect this reality. On this research, we investigated interference of 4 bio-promising carbon nanomaterials (graphene acid (GA), cyanographene (GCN), graphitic carbon nitride (g-C3N4) and carbon dots (QCDs)) in generally used LIVE/DEAD assay.

When a regular process was utilized, supplies prompted varied sorts of interference. Whereas positively charged g-C3N4 and QCDs induced false outcomes by means of the creation of free agglomerates and intrinsic fluorescence properties, negatively charged GA and GCN led to false indicators as a result of advanced quenching impact of the fluorescent dye of a LIVE/DEAD package. Thus, we developed a brand new strategy utilizing a particular gating technique primarily based on extra controls that efficiently overcame all sorts of interference and result in dependable ends in LIVE/DEAD assay.

We advise that the newly developed process ought to be a compulsory device for all in vitro circulation cytometry assays of any class of carbon nanomaterials. Imaging circulation cytometry permits for the quantitative evaluation of fluorescent indicators on the subcellular degree. Right here, we describe using a biosensor cell line, particularly, U2OS osteosarcoma cells outfitted with a fusion protein comprising monomeric pink fluorescent protein (mRFP), inexperienced fluorescent protein (GFP) and microtubule-associated proteins 1A/1B gentle chain 3B (greatest often called LC3), for the evaluation of autophagic flux by imaging circulation cytometry.

Highly sensitive detection of antibody nonspecific interactions using flow cytometry

We element all evaluation instruments required to tell apart autophagosomes (that emit each a pink and a inexperienced fluorescence) and autolysosomes (that emit a pink fluorescence, but lose the inexperienced fluorescent sign) and to quantitate autophagic flux in a handy style. Our information, nevertheless, present that information of the kinetics of the interplay permits to reconcile the info obtained by circulation cytometry and LigandTracer and show the complementarity of those two strategies.

Okay D willpower from time-resolved experiments on stay cells with LigandTracer and reconciliation with end-point circulation cytometry measurements

Design of next-generation therapeutics comes with new challenges and emulates expertise and strategies to satisfy them. Characterizing the binding of both pure ligands or therapeutic proteins to cell-surface receptors, for which related recombinant variations could not exist, represents certainly one of these challenges. Right here we report the characterization of the interplay of 5 totally different antibody therapeutics (Trastuzumab, Rituximab, Panitumumab, Pertuzumab, and Cetuximab) with their cognate goal receptors utilizing LigandTracer.

anti-MCCC2

YF-PA20435 50 ul
EUR 363
Description: Mouse polyclonal to MCCC2

anti-MCCC2

YF-PA20436 50 ug
EUR 363
Description: Mouse polyclonal to MCCC2

anti-MCCC2

YF-PA20437 100 ug
EUR 403
Description: Rabbit polyclonal to MCCC2

anti-MCCC2

YF-PA26541 50 ul
EUR 334
Description: Mouse polyclonal to MCCC2

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

Anti-MCCC2 (2B3)

YF-MA19192 100 ug
EUR 363
Description: Mouse monoclonal to MCCC2

MCCC2 antibody

70R-18436 50 ul
EUR 435
Description: Rabbit polyclonal MCCC2 antibody

MCCC2 Antibody

1-CSB-PA867199ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MCCC2. Recognizes MCCC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

MCCC2 Antibody

DF12655 200ul
EUR 304
Description: MCCC2 Antibody detects endogenous levels of MCCC2.

MCCC2 Antibody

1-CSB-PA013573GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MCCC2. Recognizes MCCC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MCCC2 Polyclonal Antibody

28858-100ul 100ul
EUR 252

MCCC2 Polyclonal Antibody

28858-50ul 50ul
EUR 187

MCCC2 Polyclonal Antibody

31405-100ul 100ul
EUR 252

MCCC2 Polyclonal Antibody

31405-50ul 50ul
EUR 187

Mccc2/ Rat Mccc2 ELISA Kit

ELI-48233r 96 Tests
EUR 886

MCCC2 siRNA

20-abx903187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCCC2 siRNA

20-abx923707
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MCCC2 siRNA

20-abx923708
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal MCCC2 Antibody (Center)

APR10893G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MCCC2 (Center). This antibody is tested and proven to work in the following applications:

MCCC2 Polyclonal Conjugated Antibody

C28858 100ul
EUR 397

MCCC2 Polyclonal Conjugated Antibody

C31405 100ul
EUR 397

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

MCCC2 Blocking Peptide

DF12655-BP 1mg
EUR 195

MCCC2 cloning plasmid

CSB-CL867199HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 990
  • Sequence: atgtgggccgtcctgaggttagccctgcggccgtgtgcccgcgcctctcccgccgggccgcgcgcctatcacggggactcggtggcctcgctgggcacccagccggacttgggctctgccctctaccaggagaactacaagcagatgaaagcactagtaaatcagctccatgaacg
  • Show more
Description: A cloning plasmid for the MCCC2 gene.

MCCC2 cloning plasmid

CSB-CL867199HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1692
  • Sequence: atgtgggccgtcctgaggttagccctgcggccgtgtgcccgcgcctctcccgccgggccgcgcgcctatcacggggactcggtggcctcgctgggcacccagccggacttgggctctgccctctaccaggagaactacaagcagatgaaagcactagtaaatcagctccatgaac
  • Show more
Description: A cloning plasmid for the MCCC2 gene.

MCCC2 Rabbit pAb

A7990-100ul 100 ul
EUR 308

MCCC2 Rabbit pAb

A7990-200ul 200 ul
EUR 459

MCCC2 Rabbit pAb

A7990-20ul 20 ul
EUR 183

MCCC2 Rabbit pAb

A7990-50ul 50 ul
EUR 223

MCCC2 Rabbit pAb

A15181-100ul 100 ul
EUR 308

MCCC2 Rabbit pAb

A15181-200ul 200 ul
EUR 459

MCCC2 Rabbit pAb

A15181-20ul 20 ul
EUR 183

MCCC2 Rabbit pAb

A15181-50ul 50 ul
EUR 223

[One Step] MCCC2 Antibody Kit

RK05665 50 ul
EUR 240

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

20-abx006595
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

abx037012-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

abx033068-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

abx033068-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

abx030686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

abx030686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

abx235048-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Methylcrotonoyl-CoA Carboxylase 2 (MCCC2) Antibody

20-abx322517
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human MCCC2 ELISA KIT

ELI-15862h 96 Tests
EUR 824

MCCC2 ELISA KIT|Human

EF000692 96 Tests
EUR 689

Mouse Mccc2 ELISA KIT

ELI-46423m 96 Tests
EUR 865

Rat MCCC2 shRNA Plasmid

20-abx990287
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MCCC2 shRNA Plasmid

20-abx978856
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MCCC2 shRNA Plasmid

20-abx961908
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MCCC2 Recombinant Protein (Human)

RP018958 100 ug Ask for price

MCCC2 Recombinant Protein (Human)

RP018961 100 ug Ask for price

MCCC2 Recombinant Protein (Mouse)

RP149789 100 ug Ask for price

MCCC2 Recombinant Protein (Rat)

RP211097 100 ug Ask for price

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Antibody

20-abx113712
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Antibody

20-abx131298
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Antibody

20-abx131299
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mccc2 ORF Vector (Rat) (pORF)

ORF070367 1.0 ug DNA
EUR 506

MCCC2 ORF Vector (Human) (pORF)

ORF006320 1.0 ug DNA
EUR 95

MCCC2 ORF Vector (Human) (pORF)

ORF006321 1.0 ug DNA
EUR 95

Mccc2 ORF Vector (Mouse) (pORF)

ORF049931 1.0 ug DNA
EUR 506

MCCC2 ELISA Kit (Human) (OKCD00916)

OKCD00916 96 Wells
EUR 831
Description: Description of target: Carboxyltransferase subunit of the 3-methylcrotonyl-CoA carboxylase, an enzyme that catalyzes the conversion of 3-methylcrotonyl-CoA to 3-methylglutaconyl-CoA, a critical step for leucine and isovaleric acid catabolism.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"Expression, purification, characterization of human 3-methylcrotonyl-CoA carboxylase (MCCC)."_x005F_x005F_x000D_Chu C.H., Cheng D._x005F_x005F_x000D_Protein Expr. Purif. 53:421-427(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, CATALYTIC ACTIVITY, BIOPHYSICOCHEMICAL PROPERTIES. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.141 ng/mL

Mccc2 sgRNA CRISPR Lentivector set (Rat)

K7573601 3 x 1.0 ug
EUR 339

MCCC2 sgRNA CRISPR Lentivector set (Human)

K1278301 3 x 1.0 ug
EUR 339

Mccc2 sgRNA CRISPR Lentivector set (Mouse)

K3464301 3 x 1.0 ug
EUR 339

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human)

4-PAD690Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2)

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse)

4-PAD690Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2)

Mccc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7573602 1.0 ug DNA
EUR 154

Mccc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7573603 1.0 ug DNA
EUR 154

Mccc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7573604 1.0 ug DNA
EUR 154

MCCC2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1278302 1.0 ug DNA
EUR 154

MCCC2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1278303 1.0 ug DNA
EUR 154

MCCC2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1278304 1.0 ug DNA
EUR 154

Mccc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3464302 1.0 ug DNA
EUR 154

Mccc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3464303 1.0 ug DNA
EUR 154

Mccc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3464304 1.0 ug DNA
EUR 154

MCCC2 Protein Vector (Human) (pPB-C-His)

PV025277 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPB-N-His)

PV025278 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPM-C-HA)

PV025279 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPM-C-His)

PV025280 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPB-C-His)

PV025281 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPB-N-His)

PV025282 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPM-C-HA)

PV025283 500 ng
EUR 329

MCCC2 Protein Vector (Human) (pPM-C-His)

PV025284 500 ng
EUR 329

MCCC2 Protein Vector (Rat) (pPB-C-His)

PV281466 500 ng
EUR 603

MCCC2 Protein Vector (Rat) (pPB-N-His)

PV281467 500 ng
EUR 603

MCCC2 Protein Vector (Rat) (pPM-C-HA)

PV281468 500 ng
EUR 603

MCCC2 Protein Vector (Rat) (pPM-C-His)

PV281469 500 ng
EUR 603

MCCC2 Protein Vector (Mouse) (pPB-C-His)

PV199722 500 ng
EUR 603

MCCC2 Protein Vector (Mouse) (pPB-N-His)

PV199723 500 ng
EUR 603

MCCC2 Protein Vector (Mouse) (pPM-C-HA)

PV199724 500 ng
EUR 603

MCCC2 Protein Vector (Mouse) (pPM-C-His)

PV199725 500 ng
EUR 603

Recombinant Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2)

4-RPD690Hu01
  • EUR 526.50
  • EUR 244.00
  • EUR 1699.36
  • EUR 633.12
  • EUR 1166.24
  • EUR 415.00
  • EUR 4098.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HCC0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Methylcrotonoyl Coenzyme A Carboxylase 2 expressed in: E.coli

Recombinant Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2)

4-RPD690Mu01
  • EUR 544.42
  • EUR 248.00
  • EUR 1766.56
  • EUR 655.52
  • EUR 1211.04
  • EUR 427.00
  • EUR 4266.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: B2RUK5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 expressed in: E.coli

Mccc2 3'UTR Luciferase Stable Cell Line

TU112987 1.0 ml Ask for price

Mccc2 3'UTR GFP Stable Cell Line

TU162987 1.0 ml Ask for price

Mccc2 3'UTR Luciferase Stable Cell Line

TU212953 1.0 ml Ask for price

Mccc2 3'UTR GFP Stable Cell Line

TU262953 1.0 ml Ask for price

MCCC2 3'UTR GFP Stable Cell Line

TU063103 1.0 ml
EUR 1521

MCCC2 3'UTR Luciferase Stable Cell Line

TU013103 1.0 ml
EUR 1521

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), APC

4-PAD690Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with APC.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), Biotinylated

4-PAD690Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with Biotin.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), Cy3

4-PAD690Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with Cy3.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), FITC

4-PAD690Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with FITC.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), HRP

4-PAD690Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with HRP.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), PE

4-PAD690Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with PE.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), APC

4-PAD690Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with APC.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), Biotinylated

4-PAD690Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with Biotin.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), Cy3

4-PAD690Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with Cy3.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), FITC

4-PAD690Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with FITC.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), HRP

4-PAD690Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with HRP.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), PE

4-PAD690Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with PE.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Protein

20-abx650437
  • EUR 732.00
  • EUR 286.00
  • EUR 2291.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Protein

20-abx650438
  • EUR 759.00
  • EUR 300.00
  • EUR 2374.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MCCC2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712203 1.0 ug DNA
EUR 316

MCCC2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712207 1.0 ug DNA
EUR 316

MCCC2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712208 1.0 ug DNA
EUR 316

MCCC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV655585 1.0 ug DNA
EUR 682

MCCC2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV655589 1.0 ug DNA
EUR 682

MCCC2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV655590 1.0 ug DNA
EUR 682

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Human), APC-Cy7

4-PAD690Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Arg337~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with APC-Cy7.

Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAD690Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MCCC2 (Ser380~Met563)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). This antibody is labeled with APC-Cy7.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) ELISA Kit

20-abx258564
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) CLIA Kit

20-abx494354
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) ELISA Kit

SED690Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) in serum, plasma, tissue homogenates and other biological fluids.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) ELISA Kit

SED690Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) in serum, plasma, tissue homogenates and other biological fluids.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) ELISA Kit

SED690Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) in serum, plasma, tissue homogenates and other biological fluids.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) ELISA Kit

SED690Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) in serum, plasma, tissue homogenates and other biological fluids.

Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) ELISA Kit

4-SED690Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Methylcrotonoyl Coenzyme A Carboxylase 2 elisa. Alternative names of the recognized antigen: MCCB
  • 3-methylcrotonyl-CoA carboxylase non-biotin-containing subunit
  • 3-methylcrotonyl-CoA:carbon dioxide ligase subunit beta
  • 3-methylcrotonyl
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human MCCC2 (Methylcrotonoyl Coenzyme A Carboxylase 2)

ELK5290 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Methylcrotonoyl Coenzyme A Carboxylase 2 (MCCC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibo
  • Show more
Description: A sandwich ELISA kit for detection of Methylcrotonoyl Coenzyme A Carboxylase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7573605 3 x 1.0 ug
EUR 376

MCCC2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1278305 3 x 1.0 ug
EUR 376

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3464305 3 x 1.0 ug
EUR 376

MCCC2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV712204 1.0 ug DNA
EUR 316

MCCC2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV712205 1.0 ug DNA
EUR 374

MCCC2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV712206 1.0 ug DNA
EUR 374

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7573606 1.0 ug DNA
EUR 167

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7573607 1.0 ug DNA
EUR 167

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7573608 1.0 ug DNA
EUR 167

MCCC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV655586 1.0 ug DNA
EUR 682

MCCC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV655587 1.0 ug DNA
EUR 740

MCCC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV655588 1.0 ug DNA
EUR 740

MCCC2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1278306 1.0 ug DNA
EUR 167

MCCC2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1278307 1.0 ug DNA
EUR 167

MCCC2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1278308 1.0 ug DNA
EUR 167

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3464306 1.0 ug DNA
EUR 167

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3464307 1.0 ug DNA
EUR 167

Mccc2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3464308 1.0 ug DNA
EUR 167

ELISA kit for Human Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCC2)

KTE61696-48T 48T
EUR 332
  • MCCC2 is the small subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonyl
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCC2)

KTE61696-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MCCC2 is the small subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonyl
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCC2)

KTE61696-96T 96T
EUR 539
  • MCCC2 is the small subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonyl
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Anti-Anti-DDB1 Antibody

A00333 100uL
EUR 455
Description: Rabbit Polyclonal DDB1 Antibody. Validated in IP and tested in Human, Mouse.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

AEA465Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for Antibody Detection.detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in serum, plasma and other biological fluids.

Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) ELISA Kit

4-AEA465Hu
  • EUR 5698.00
  • EUR 3011.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Sperm Antibody elisa. Alternative names of the recognized antigen: Anti-Spermatozoa Antibodies
  • Sperm Antibodies
  • Antisperm Antibodies
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Anti-Anti-Sperm Antibody Antibody (Anti-AsAb) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-AsAb (Anti-Anti-Sperm Antibody Antibody)

ELK8071 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Anti-Sperm Antibody Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Anti-CYFIP2 Antibody

A06562 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for CYFIP2 Antibody (CYFIP2) detection.tested for IHC, WB in Human, Mouse, Rat.

Anti-GPS2 Antibody

A06569 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for GPS2 Antibody (GPS2) detection. Tested with WB in Human, Mouse, Rat.

Anti-PRKX Antibody

A06585-1 100ul
EUR 397
Description: Rabbit Polyclonal PRKX Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-PPA2 Antibody

A06587 100ug/vial
EUR 294

Anti-GluR8 Antibody

A06589 100ul
EUR 397
Description: Rabbit Polyclonal GluR8 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-EDG7 Antibody

A06597-1 100ul
EUR 397
Description: Rabbit Polyclonal EDG7 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.

Anti-KIR2.3 Antibody

A06605-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for KIR2.3 Antibody (KCNJ4) detection. Tested with WB in Human, Mouse, Rat.

Anti-GALK1 Antibody

A06627 100ul
EUR 397
Description: Rabbit Polyclonal GALK1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-PRAME Antibody

A06628-2 100ug/vial
EUR 294

Anti-GP2 Antibody

A06630-1 100ug/vial
EUR 334

The tactic provides the benefit of being carried out on stay cells, assuaging the necessity for a recombinant supply of the receptor. Moreover, time-resolved measurements, along with permitting the willpower of the affinity of the studied drug to its goal, give entry to the binding kinetics thereby offering a full characterization of the system. On this research, we additionally in contrast time-resolved LigandTracer information with end-point OkayD willpower from circulation cytometry experiments and hypothesize that discrepancies between these two approaches, once they exist, typically come from circulation cytometry titration curves being acquired previous to full equilibration of the system.

Leave a Reply

Your email address will not be published. Required fields are marked *