Unsupervised flow cytometry analysis in hematological malignancies: A new paradigm

Unsupervised flow cytometry analysis in hematological malignancies: A new paradigm

Ever since hematopoietic cells grew to become “occasions” enumerated and characterised in suspension by cell counters or move cytometers, researchers and engineers have strived to refine the acquisition and show of the digital alerts generated. A big array of options was then developed to establish at finest the quite a few cell subsets that may be delineated, notably amongst hematopoietic cells. As devices grew to become increasingly secure and sturdy, the main target moved to analytic software program. Nearly concomitantly, the capability elevated to make use of massive panels (each with mass and classical cytometry) and to use synthetic intelligence/machine studying for his or her evaluation.

The mix of those ideas raised new analytical potentialities, opening an unprecedented subject of refined exploration for a lot of situations, together with hematopoiesis and hematological issues. On this assessment, the final ideas and progress achieved within the growth of recent analytical approaches for exploring high-dimensional knowledge units on the single-cell stage will likely be described as they appeared over the previous few years. A bigger and extra sensible half will element the assorted steps that should be mastered, each in knowledge acquisition and within the preanalytical test of information recordsdata.

Lastly, a step-by-step rationalization of the answer in growth to mix the Bioconductor clustering algorithm FlowSOM and the favored and broadly used software program Kaluza® (Beckman Coulter) will likely be introduced. The goal of this assessment was to level out that the day when these progresses will attain routine hematology laboratories doesn’t appear so far-off.

Detection of Immune Checkpoint Receptors – A Present Problem in Scientific Movement Cytometry

Immunological remedy ideas are more and more figuring out fashionable drugs. They’re used to deal with ailments of the immune system, for tumors, but additionally for infections, neurological ailments, and plenty of others. Most of those therapies base on antibodies, however small molecules, soluble receptors or cells and modified cells are additionally used. The event of immune checkpoint inhibitors is amazingly quick. T-cell directed antibody therapies in opposition to PD-1 or CTLA-Four are already firmly established within the clinic. Additional targets are continually being added and it’s changing into more and more clear that their expression just isn’t solely related on T cells. Moreover, we don’t but have any expertise with the long-term systemic results of the therapy.

Movement cytometry can be utilized for prognosis, monitoring, and detection of unwanted effects. On this assessment, we concentrate on checkpoint molecules as goal molecules and purposeful markers of cells of the innate and purchased immune system. Nonetheless, for many of the attention-grabbing and doubtlessly related parameters, there are nonetheless no take a look at kits appropriate for routine use. Right here we give an outline of the detection of checkpoint molecules on immune cells within the peripheral blood and present examples of a potential design of antibody panels.

The design of focused nanomedicines requires intracellular space- and time-resolved knowledge of nanoparticle distribution following uptake. Present strategies to review intracellular trafficking, akin to dynamic colocalization by fluorescence microscopy in stay cells, are normally low throughput and require in depth evaluation of enormous datasets to quantify colocalization in a number of particular person cells. Right here a way primarily based on move cytometry to simply detect and characterize the organelles through which nanoparticles are internalized and trafficked over time is proposed.

Unsupervised flow cytometry analysis in hematological malignancies: A new paradigm

Standard cell fractionation strategies are mixed with immunostaining and high-sensitivity organelle move cytometry to get space-resolved knowledge of nanoparticle intracellular distribution. By extracting the organelles at completely different instances, time-resolved knowledge of nanoparticle intracellular trafficking are obtained. The strategy is validated by figuring out how nanoparticle measurement impacts the kinetics of arrival to the lysosomes. The outcomes reveal that this methodology permits high-throughput evaluation of nanoparticle uptake and intracellular trafficking by cells, subsequently it may be used to find out how nanoparticle design impacts their intracellular habits.

Movement cytometry knowledge mining by cytoChain identifies determinants of exhaustion and stemness in TCR-engineered T cells

The phenotype of infused cells is a serious determinant of Adoptive T-cell remedy (ACT) efficacy. But, the problem in deciphering multiparametric cytometry knowledge restricted the high quality characterization of mobile merchandise. To permit the evaluation of dynamic and sophisticated move cytometry samples we developed cytoChain, a novel dataset mining instrument and a brand new analytical workflow. CytoChain was challenged to match state-of-the-art and revolutionary tradition situations to generate stem-like reminiscence cells (TSCM ) appropriate for ACT. Noticeably, the mix of IL-7/15 and super-oxides scavenging sustained the emergence of a beforehand un-identified non-exhausted Match-TSCM signature, ignored by handbook gating and endowed with superior growth potential.

CytoChain proficiently traced again this inhabitants in unbiased datasets, and in T-cell receptor engineered lymphocytes. cytoChain flexibility and performance had been then additional validated on a broadcast dataset from circulating T cells in COVID-19 sufferers. Collectively, our outcomes assist using cytoChain to establish novel, functionally essential immunophenotypes for ACT and sufferers immunomonitoring. This text is protected by copyright. All rights reserved. Environment friendly doubled haploid (DH) plant manufacturing is of nice curiosity within the plant breeding business and analysis as a result of homozygous traces are obtained inside a single era shortening the breeding cycle considerably.

SDCCAG8 Antibody

43294-100ul 100ul
EUR 252

SDCCAG8 Antibody

DF8846 200ul
EUR 304
Description: SDCCAG8 Antibody detects endogenous levels of total SDCCAG8.

SDCCAG8 Antibody

1-CSB-PA006722
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SDCCAG8. Recognizes SDCCAG8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

SDCCAG8 antibody

70R-4002 50 ug
EUR 467
Description: Rabbit polyclonal SDCCAG8 antibody raised against the N terminal of SDCCAG8

SDCCAG8 antibody

70R-4128 50 ug
EUR 467
Description: Rabbit polyclonal SDCCAG8 antibody raised against the middle region of SDCCAG8

SDCCAG8 Antibody

1-CSB-PA020899GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SDCCAG8. Recognizes SDCCAG8 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

SDCCAG8 Antibody

ABD8846 100 ug
EUR 438

Mouse Monoclonal Anti-Actin (Pan, alpha, beta, gamma) IgG-Cy3 conjugate

ACTB24-Cy3 100 ul
EUR 408

Goat Anti-Mouse IgG-Cy3 Conjugate (Adsorbed with Bov, Ch, Gt, Gp, Ha, Hs, Hu, Rb, Sh)

40337-Cy3 0.5 ml
EUR 263

anti- SDCCAG8 antibody

FNab07666 100µg
EUR 505.25
  • Immunogen: serologically defined colon cancer antigen 8
  • Uniprot ID: Q86SQ7
  • Gene ID: 10806
  • Research Area: Metabolism
Description: Antibody raised against SDCCAG8

Anti-SDCCAG8 antibody

PAab07666 100 ug
EUR 355

Anti-SDCCAG8 antibody

STJ72779 100 µg
EUR 359

SDCCAG8 siRNA

20-abx932704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDCCAG8 siRNA

20-abx932705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SDCCAG8

YF-PA17224 50 ul
EUR 363
Description: Mouse polyclonal to SDCCAG8

anti-SDCCAG8

YF-PA17225 50 ug
EUR 363
Description: Mouse polyclonal to SDCCAG8

Polyclonal SDCCAG8 Antibody (Internal)

APG01216G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (Internal). This antibody is tested and proven to work in the following applications:

SDCCAG8 Blocking Peptide

33R-3716 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDCCAG8 antibody, catalog no. 70R-4002

SDCCAG8 Blocking Peptide

33R-4109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDCCAG8 antibody, catalog no. 70R-4128

SDCCAG8 Blocking Peptide

DF8846-BP 1mg
EUR 195

SDCCAG8 Blocking Peptide

20-abx161437
  • EUR 606.00
  • EUR 1428.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

SDCCAG8 cloning plasmid

CSB-CL020899HU-10ug 10ug
EUR 413
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atggcgaagtccccggagaactctaccctggaggagattctggggcagtatcaacggagtctccgggaacatgccagcagaagcattcaccaactgacatgtgccctgaaagaaggcgatgtcactattggagaagatgcaccaaatctttcttttagcaccagtgtgggaaatg
  • Show more
Description: A cloning plasmid for the SDCCAG8 gene.

Polyclonal SDCCAG8 Antibody (internal region)

APG00810G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal SDCCAG8 Antibody (aa469-483)

APG01240G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (aa469-483). This antibody is tested and proven to work in the following applications:

Anti-SDCCAG8 (aa469-483) antibody

STJ72780 100 µg
EUR 359

Cy3 Conjugated Avidin

BA1037 0.5ml
EUR 162

Mouse Sdccag8 ELISA KIT

ELI-13424m 96 Tests
EUR 865

Human SDCCAG8 ELISA KIT

ELI-29645h 96 Tests
EUR 824

SDCCAG8 ELISA KIT|Human

EF002773 96 Tests
EUR 689

Mouse SDCCAG8 shRNA Plasmid

20-abx978693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SDCCAG8 shRNA Plasmid

20-abx957365
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-SDCCAG8 Plasmid

PVT16613 2 ug
EUR 325

SDCCAG8 Recombinant Protein (Human)

RP096258 100 ug Ask for price

SDCCAG8 Recombinant Protein (Rat)

RP227798 100 ug Ask for price

SDCCAG8 Recombinant Protein (Mouse)

RP170432 100 ug Ask for price

Polyclonal SDCCAG8 (aa469-483) Antibody (internal region)

APG00811G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SDCCAG8 (aa469-483) (internal region). This antibody is tested and proven to work in the following applications:

Sdccag8 ORF Vector (Rat) (pORF)

ORF075934 1.0 ug DNA
EUR 506

SDCCAG8 ORF Vector (Human) (pORF)

ORF032087 1.0 ug DNA
EUR 405

Sdccag8 ORF Vector (Mouse) (pORF)

ORF056812 1.0 ug DNA
EUR 506

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

20-abx115458
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

20-abx121727
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx029545-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx029545-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx237666-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

20-abx325189
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx432203-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) Antibody

abx432204-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Sdccag8 sgRNA CRISPR Lentivector set (Rat)

K7466701 3 x 1.0 ug
EUR 339

Sdccag8 sgRNA CRISPR Lentivector set (Mouse)

K3434501 3 x 1.0 ug
EUR 339

SDCCAG8 sgRNA CRISPR Lentivector set (Human)

K2108401 3 x 1.0 ug
EUR 339

Goat Anti-Rabbit IgG Secondary Antibody Cy3 Conjugated

L30111 1.0 ml
EUR 112

Goat Anti-Human IgG Secondary Antibody Cy3 Conjugated

L30211 1.0 ml
EUR 112

Goat Anti-Mouse IgG Secondary Antibody Cy3 Conjugated

L30311 1.0 ml
EUR 112

Sdccag8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7466702 1.0 ug DNA
EUR 154

Sdccag8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7466703 1.0 ug DNA
EUR 154

Sdccag8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7466704 1.0 ug DNA
EUR 154

Sdccag8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3434502 1.0 ug DNA
EUR 154

Sdccag8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3434503 1.0 ug DNA
EUR 154

Sdccag8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3434504 1.0 ug DNA
EUR 154

SDCCAG8 sgRNA CRISPR Lentivector (Human) (Target 1)

K2108402 1.0 ug DNA
EUR 154

SDCCAG8 sgRNA CRISPR Lentivector (Human) (Target 2)

K2108403 1.0 ug DNA
EUR 154

SDCCAG8 sgRNA CRISPR Lentivector (Human) (Target 3)

K2108404 1.0 ug DNA
EUR 154

SDCCAG8 Protein Vector (Human) (pPB-C-His)

PV128346 500 ng
EUR 552

SDCCAG8 Protein Vector (Human) (pPB-N-His)

PV128347 500 ng
EUR 552

SDCCAG8 Protein Vector (Human) (pPM-C-HA)

PV128348 500 ng
EUR 552

SDCCAG8 Protein Vector (Human) (pPM-C-His)

PV128349 500 ng
EUR 552

SDCCAG8 Protein Vector (Rat) (pPB-C-His)

PV303734 500 ng
EUR 1166

SDCCAG8 Protein Vector (Rat) (pPB-N-His)

PV303735 500 ng
EUR 1166

SDCCAG8 Protein Vector (Rat) (pPM-C-HA)

PV303736 500 ng
EUR 1166

SDCCAG8 Protein Vector (Rat) (pPM-C-His)

PV303737 500 ng
EUR 1166

SDCCAG8 Protein Vector (Mouse) (pPB-C-His)

PV227246 500 ng
EUR 1065

SDCCAG8 Protein Vector (Mouse) (pPB-N-His)

PV227247 500 ng
EUR 1065

SDCCAG8 Protein Vector (Mouse) (pPM-C-HA)

PV227248 500 ng
EUR 1065

SDCCAG8 Protein Vector (Mouse) (pPM-C-His)

PV227249 500 ng
EUR 1065

Sdccag8 3'UTR Luciferase Stable Cell Line

TU118462 1.0 ml Ask for price

Sdccag8 3'UTR GFP Stable Cell Line

TU168462 1.0 ml Ask for price

Sdccag8 3'UTR Luciferase Stable Cell Line

TU220027 1.0 ml Ask for price

Sdccag8 3'UTR GFP Stable Cell Line

TU270027 1.0 ml Ask for price

SDCCAG8 3'UTR GFP Stable Cell Line

TU072786 1.0 ml
EUR 1394

SDCCAG8 3'UTR Luciferase Stable Cell Line

TU022786 1.0 ml
EUR 1394

SDCCAG8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV637435 1.0 ug DNA
EUR 1355

SDCCAG8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV637439 1.0 ug DNA
EUR 1355

SDCCAG8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV637440 1.0 ug DNA
EUR 1355

Cy3 Conjugated anti-Mouse IgG SABC Kit

SA1072 1 kit
EUR 355

Cy3 Conjugated anti-Mouse IgM SABC Kit

SA1073 1 kit
EUR 375

Cy3 Conjugated anti-Rabbit IgG SABC Kit

SA1074 1 kit
EUR 355

Cy3 Conjugated anti-Goat IgG SABC Kit

SA1076 1 kit
EUR 355

Cy3 Conjugated anti-Human IgG SABC Kit

SA1078 1 kit
EUR 355

Cy3 Conjugated anti-Rat IgG SABC Kit

SA1079 1 kit
EUR 355

Cy3 Conjugated Goat Anti-Mouse IgG (H+L) secondary antibody

BA1031 0.5ml
EUR 182

Cy3 Conjugated Goat Anti-Rabbit IgG (H+L) secondary antibody

BA1032 0.5ml
EUR 182

Cy3 Conjugated Rabbit Anti-Goat IgG (H+L) secondary antibody

BA1034 0.5ml
EUR 182

Cy3 Conjugated Rabbit Anti-Human IgG (H+L) secondary antibody

BA1035 0.5ml
EUR 182

Cy3 tertrazine [Cy3 tertrazine]

910 1 mg
EUR 219
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Goat Anti-Rabbit IgG(H+L) CY3–conjugated

S0011 200ul
EUR 304

Goat Anti-Mouse IgG(H+L) CY3–conjugated

S0012 200ul
EUR 304

Fluorescein Isothiocyanate (Cy3) Monoclonal Antibody (Pan-species), Cy3

4-MAO843Ge21-Cy3
  • EUR 420.00
  • EUR 4349.00
  • EUR 1181.00
  • EUR 547.00
  • EUR 252.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Pan-species Fluorescein Isothiocyanate (Cy3). This antibody is labeled with Cy3.

CY3

HY-D0822 5mg
EUR 354

Synaptophysin (SYP) Antibody (Cy3)

20-abx274282
  • EUR 551.00
  • EUR 272.00
  • EUR 1706.00
  • EUR 787.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Podoplanin (PDPN) Antibody (Cy3)

20-abx274445
  • EUR 551.00
  • EUR 272.00
  • EUR 1720.00
  • EUR 787.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Serologically Defined Colon Cancer Antigen 8 (SDCCAG8) ELISA Kit

abx383072-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7466705 3 x 1.0 ug
EUR 376

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3434505 3 x 1.0 ug
EUR 376

SDCCAG8 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2108405 3 x 1.0 ug
EUR 376

SDCCAG8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV637436 1.0 ug DNA
EUR 1355

SDCCAG8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV637437 1.0 ug DNA
EUR 1413

SDCCAG8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV637438 1.0 ug DNA
EUR 1413

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7466706 1.0 ug DNA
EUR 167

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7466707 1.0 ug DNA
EUR 167

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7466708 1.0 ug DNA
EUR 167

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3434506 1.0 ug DNA
EUR 167

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3434507 1.0 ug DNA
EUR 167

Sdccag8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3434508 1.0 ug DNA
EUR 167

SDCCAG8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2108406 1.0 ug DNA
EUR 167

SDCCAG8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2108407 1.0 ug DNA
EUR 167

SDCCAG8 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2108408 1.0 ug DNA
EUR 167

Cy3 tyramide

11065 1 mg
EUR 132
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Cy3 phosphoramidite

6070 100 umoles
EUR 50
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

DBCO-Cy3

920 1 mg
EUR 132
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12171501

Cy3-dUTP

B8202-.025 25 ?l (1mM)
EUR 282
Description: Cy3-dUTP can be used for direct enzymatic labeling of DNA/cDNA by PCR with Taq polymerase, Nick Translation with DNAse I/ DNA Polymerase I, cDNA labeling and 3?-end labeling

Cy3-dUTP

B8202-.125 5x25 ?l (1mM)
EUR 1024
Description: Cy3-dUTP can be used for direct enzymatic labeling of DNA/cDNA by PCR with Taq polymerase, Nick Translation with DNAse I/ DNA Polymerase I, cDNA labeling and 3?-end labeling

Cy3-dCTP

B8203-.025 25 ?l (1mM)
EUR 282
Description: Cy3-dCTP can be used for direct enzymatic labeling of DNA/cDNA by PCR with Taq polymerase, Nick Translation with DNAse I/ DNA Polymerase I, cDNA labeling and 3?-end labeling

Cy3-dCTP

B8203-.125 5x25 ?l (1mM)
EUR 1024
Description: Cy3-dCTP can be used for direct enzymatic labeling of DNA/cDNA by PCR with Taq polymerase, Nick Translation with DNAse I/ DNA Polymerase I, cDNA labeling and 3?-end labeling

Cy3 azide

A8127-25 25 mg
EUR 1732
Description: Sulfo-Cy3 azide is a sulfonated, hydrophilic and highly water soluble dye for Click Chemistry. For labeling of various molecules in aqueous phase for brightness and photostability of fluorophore, sulfo-Cy3 azide is an ideal choice.

Cy3 azide

A8127-5 5 mg
EUR 618
Description: Sulfo-Cy3 azide is a sulfonated, hydrophilic and highly water soluble dye for Click Chemistry. For labeling of various molecules in aqueous phase for brightness and photostability of fluorophore, sulfo-Cy3 azide is an ideal choice.

CY3-YNE

HY-D0818 10mM/1mL
EUR 691

CY3-SE

HY-D0823 25mg
EUR 1496

Keratin 7 (KRT7) Antibody (Cy3)

20-abx274268
  • EUR 551.00
  • EUR 272.00
  • EUR 1692.00
  • EUR 773.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Uroplakin 2 (UPK2) Antibody (Cy3)

20-abx274287
  • EUR 592.00
  • EUR 286.00
  • EUR 1887.00
  • EUR 857.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

EZLabel? Antibody Cy3 Labeling Kit

K836-5
EUR 354

Asprosin Polyclonal Antibody (Human), Cy3

4-PAA332Hu01-Cy3
  • EUR 542.00
  • EUR 6089.00
  • EUR 1616.00
  • EUR 721.00
  • EUR 303.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Asprosin. This antibody is labeled with Cy3.

Vinculin (VCL) Polyclonal Antibody (Human), Cy3

4-CAB839Hu01-Cy3
  • EUR 377.00
  • EUR 3725.00
  • EUR 1025.00
  • EUR 485.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Lys1020~Gln1134
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vinculin (VCL). This antibody is labeled with Cy3.

Amphiregulin (AREG) Polyclonal Antibody (Bovine), Cy3

4-PAA006Bo01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AREG (Leu27~Ala247)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Amphiregulin (AREG). This antibody is labeled with Cy3.

Amphiregulin (AREG) Polyclonal Antibody (Rat), Cy3

4-PAA006Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AREG (Val97~Ala243)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Amphiregulin (AREG). This antibody is labeled with Cy3.

Angiogenin (ANG) Polyclonal Antibody (Bovine), Cy3

4-PAA007Bo01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANG (Ala24~His148)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Angiogenin (ANG). This antibody is labeled with Cy3.

Angiogenin (ANG) Polyclonal Antibody (Human), Cy3

4-PAA007Hu01-Cy3
  • EUR 313.00
  • EUR 2813.00
  • EUR 797.00
  • EUR 393.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANG (Gln25~Pro147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Angiogenin (ANG). This antibody is labeled with Cy3.

Angiogenin (ANG) Polyclonal Antibody (Mouse), Cy3

4-PAA007Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANG (Gln25~Leu145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Angiogenin (ANG). This antibody is labeled with Cy3.

Angiogenin (ANG) Polyclonal Antibody (Mouse), Cy3

4-PAA007Mu02-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANG (Gln25~Leu145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Angiogenin (ANG). This antibody is labeled with Cy3.

Angiogenin (ANG) Polyclonal Antibody (Pig), Cy3

4-PAA007Po01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANG (Lys1~Gln123)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Angiogenin (ANG). This antibody is labeled with Cy3.

Angiogenin (ANG) Polyclonal Antibody (Rat), Cy3

4-PAA007Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ANG (Gln25~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Angiogenin (ANG). This antibody is labeled with Cy3.

Erythropoietin (EPO) Polyclonal Antibody (Human), Cy3

4-PAA028Hu01-Cy3
  • EUR 410.00
  • EUR 4205.00
  • EUR 1145.00
  • EUR 533.00
  • EUR 247.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPO (Ala28~Arg193)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Erythropoietin (EPO). This antibody is labeled with Cy3.

Erythropoietin (EPO) Polyclonal Antibody (Human), Cy3

4-PAA028Hu06-Cy3
  • EUR 410.00
  • EUR 4205.00
  • EUR 1145.00
  • EUR 533.00
  • EUR 247.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ala28~Arg193
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Erythropoietin (EPO). This antibody is labeled with Cy3.

Erythropoietin (EPO) Polyclonal Antibody (Mouse), Cy3

4-PAA028Mu01-Cy3
  • EUR 301.00
  • EUR 2645.00
  • EUR 755.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPO (Val82~Arg192)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Erythropoietin (EPO). This antibody is labeled with Cy3.

Erythropoietin (EPO) Polyclonal Antibody (Mouse), Cy3

4-PAA028Mu02-Cy3
  • EUR 300.00
  • EUR 2621.00
  • EUR 749.00
  • EUR 374.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPO (Val82~Arg192)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Erythropoietin (EPO). This antibody is labeled with Cy3.

Erythropoietin (EPO) Polyclonal Antibody (Pig), Cy3

4-PAA028Po01-Cy3
  • EUR 443.00
  • EUR 4661.00
  • EUR 1259.00
  • EUR 578.00
  • EUR 260.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPO (Ala27~Arg194)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Pig Erythropoietin (EPO). This antibody is labeled with Cy3.

Erythropoietin (EPO) Polyclonal Antibody (Rat), Cy3

4-PAA028Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPO (Pro28~Arg192)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Erythropoietin (EPO). This antibody is labeled with Cy3.

Utrophin (UTRN) Polyclonal Antibody (Human), Cy3

4-PAF959Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UTRN (Met1~Glu252)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Utrophin (UTRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human), Cy3

4-PAG316Hu02-Cy3
  • EUR 338.00
  • EUR 3173.00
  • EUR 887.00
  • EUR 429.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser448~Glu579)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human), Cy3

4-PAG316Hu03-Cy3
  • EUR 338.00
  • EUR 3173.00
  • EUR 887.00
  • EUR 429.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Arg134~Pro573)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Human), Cy3

4-PAG316Hu04-Cy3
  • EUR 338.00
  • EUR 3173.00
  • EUR 887.00
  • EUR 429.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Thr807~Thr1038)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Mouse), Cy3

4-PAG316Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Ser521~Thr637)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Mouse), Cy3

4-PAG316Mu02-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Gln334~Ser477)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Corin (CRN). This antibody is labeled with Cy3.

Corin (CRN) Polyclonal Antibody (Rat), Cy3

4-PAG316Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CRN (Pro533~Gln634)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Corin (CRN). This antibody is labeled with Cy3.

Calbindin (CALB) Polyclonal Antibody (Rat), Cy3

4-PAG438Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CALB (Ala2~Asn261)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Calbindin (CALB). This antibody is labeled with Cy3.

Statherin (STATH) Polyclonal Antibody (Human), Cy3

4-PAG441Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STATH (Met1~Phe62)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Statherin (STATH). This antibody is labeled with Cy3.

Adenosylhomocysteinase (AHCY) Polyclonal Antibody (Human), Cy3

4-PAG465Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AHCY (Ser2~Tyr432)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Adenosylhomocysteinase (AHCY). This antibody is labeled with Cy3.

Methionine (Met) Polyclonal Antibody (General), Cy3

4-PAG466Ge01-Cy3
  • EUR 410.00
  • EUR 4205.00
  • EUR 1145.00
  • EUR 533.00
  • EUR 247.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Small Molecule, Met conjugated to OVA
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against General Methionine (Met). This antibody is labeled with Cy3.

Trichohyalin (TCHH) Polyclonal Antibody (Rat), Cy3

4-PAG480Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TCHH (Phe1851~Pro1943)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Trichohyalin (TCHH). This antibody is labeled with Cy3.

Galactosylceramidase (GALC) Polyclonal Antibody (Human), Cy3

4-PAG608Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GALC (Asp375~Asn535)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Galactosylceramidase (GALC). This antibody is labeled with Cy3.

Galactosylceramidase (GALC) Polyclonal Antibody (Rat), Cy3

4-PAG608Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GALC (Glu38~Ala156)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Galactosylceramidase (GALC). This antibody is labeled with Cy3.

Secretagogin (SCGN) Polyclonal Antibody (Rat), Cy3

4-PAG850Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with Cy3.

Vasorin (VASN) Polyclonal Antibody (Mouse), Cy3

4-PAG905Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VASN (Asn299~Ala559)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Vasorin (VASN). This antibody is labeled with Cy3.

Uromodulin (UMOD) Polyclonal Antibody (Dog), Cy3

4-PAG918Ca01-Cy3
  • EUR 461.00
  • EUR 4925.00
  • EUR 1325.00
  • EUR 605.00
  • EUR 269.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UMOD (Arg32~Glu151)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Dog Uromodulin (UMOD). This antibody is labeled with Cy3.

DH protocol growth is usually a time- and resource-consuming course of resulting from quite a few components affecting its success and effectivity. Right here we current ideas and examples about how essential success components might be recognized all through a DH protocol and an early microspore response monitored by easy impedance move cytometry (IFC) measurements, which can assist to optimize every step of an androgenesis-based DH protocol.

Leave a Reply

Your email address will not be published. Required fields are marked *