Isolation and immunophenotyping by flow cytometry of canine peripheral blood and intraepithelial and lamina propria duodenal T lymphocytes

Isolation and immunophenotyping by flow cytometry of canine peripheral blood and intraepithelial and lamina propria duodenal T lymphocytes

The intestine related lymphoid tissue (GALT) effector websites play a vital position on the pathogenesis of many immune-mediated gastrointestinal ailments. The lymphocytes at these effector websites are principally T cells which current necessary morphological, phenotypical and purposeful variations. Circulation cytometry (FC) is likely one of the mostly used methods to characterize intestinal lymphocytes in human and animal fashions. Printed research with a deal with canine for intraepithelial lymphocytes (IEL) immunophenotyping exist in very restricted numbers.

Furthermore, no lamina propria lymphocytes (LPL) isolation protocols within the canine species have been described for FC analysis. Along with immune intestinal dysregulation, imbalances within the peripheral blood immune system have been described in each human and animal gastrointestinal issues. The goal of this examine was to supply a protocol for canine IEL and LPL isolation for FC immunophenotyping of T cells subsets. Particularly, T helper, T cytotoxic, activated Th and Tc lymphocytes, regulatory, double unfavorable, double optimistic, IFN-γ and IL-Four producing T cells, and to match their respective populations between these effector websites and with the blood stream compartment in wholesome canine.

The potential relationship of those cells distributions with age, intercourse and breed was additionally evaluated. This examine included sixteen wholesome canine of various sexes and breeds with a imply age of 4.55 ± 2.93 years previous. The chosen protocols for the three immune compartments confirmed correct cell yield, purity, viability, and the absence of phenotypic and purposeful disturbances. Histologically, an satisfactory separation of the duodenal epithelium from the lamina propria was additionally noticed.

All of the proposed T cells subsets have been recognized within the three immune compartments studied, exhibiting some statistically vital variations of their distributions at these areas that spotlight the significance of their particular person analysis. This examine offers an satisfactory methodology for canine small gut IEL and LPL isolation for FC immunophenotyping and is vital for future research on the gastrointestinal immune system related to completely different canine ailments.

Circulation Cytometry Detection of Sperm DNA Fragmentation and Apoptotic Markers within the Semen of Infertile Males

The impact of sperm molecular defects on fertilization and being pregnant end result after assisted reproductive remedy (ART) is extensively documented by each analysis and medical societies. Sperm DNA fragmentation and irregular chromatin condensation symbolize essential causes of male infertility. Superior androgenic methods for precisely figuring out molecular defects assist in deciding on an applicable therapy technique. Moreover, particular markers of apoptosis are more and more necessary in predicting male infertility. The power of circulation cytometry to estimate the amount of sperm with DNA fragmentation or injury and multifactor measurements in immotile sperm have made this developed approach important in fertility facilities.

Isolation and immunophenotyping by flow cytometry of canine peripheral blood and intraepithelial and lamina propria duodenal T lymphocytes

The examine is geared toward assessing the extent of DNA fragmentation and apoptosis by measuring circulation cytometry utilizing new methods. Circulation cytometry evaluation revealed a various diploma of DNA injury. It was in a position to quantify the diploma of impairment even in samples with minimal DNA fragmentation. DNA injury was noticed even in samples that have been thought of regular with a routine semen evaluation. Circulation cytometry was delicate to adjustments in sperm apoptosis. Elevated p53 exercise ranges have been related to excessive DNA fragmentation. In the meantime, B-cell lymphoma 2 (Bcl-2) actions confirmed a unique sample. In conclusion, circulation cytometry for sperm DNA fragmentation and markers of apoptosis could be a priceless instrument in assisted reproductive facilities.

Transformation of Multicolour Circulation Cytometry knowledge with OTflow prevents deceptive multivariate evaluation (MVA) outcomes and incorrect immunological conclusions

The speedy evolution of the circulation cytometry subject, at present permitting the measurement of 30-50 parameters per cell, has led to a marked enhance in deep multivariate info. Handbook gating is inadequate to extract all this info. Due to this fact, multivariate evaluation (MVA) strategies have been developed to extract info and effectively analyse the high-density multicolour circulation cytometry (MFC) knowledge. To help interpretation, MFC knowledge are sometimes logarithmically reworked earlier than MVA.
We studied the implications of various transformations of circulation cytometry knowledge in datasets containing unfavorable intensities attributable to background subtractions and spreading error, as logarithmic transformation of unfavorable knowledge is inconceivable. Transformations akin to logicle or hyperbolic arcsine transformations permit linearity round zero, whereas larger (optimistic and unfavorable) intensities are logarithmically reworked. To outline the linear vary, a parameter (or cofactor) have to be chosen.
We present how the chosen transformation parameter has nice impression on the MVA outcomes. In some instances, peak-splitting is noticed, producing two distributions round zero in an precise homogeneous inhabitants. This can be misinterpreted because the presence of a number of cell populations. Furthermore, when performing arbitrary transformation earlier than MVA evaluation, biologically related and statistically vital info may be missed. We current a brand new algorithm, Optimum Transformation for circulation cytometry knowledge (OTflow), which makes use of numerous statistical strategies to optimally select the parameter of the transformation and forestall artifacts akin to peak splitting.

LITAF Antibody

32869-100ul 100ul
EUR 252

LITAF antibody

10R-1149 100 ul
EUR 316
Description: Mouse monoclonal LITAF antibody

LITAF Antibody

DF7357 200ul
EUR 304
Description: LITAF Antibody detects endogenous levels of total LITAF.

LITAF Antibody

1-CSB-PA012985ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LITAF. Recognizes LITAF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

LITAF Antibody

1-CSB-PA012985GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LITAF. Recognizes LITAF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LITAF siRNA

20-abx902997
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LITAF siRNA

20-abx922642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LITAF siRNA

20-abx922643
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LITAF Antibody

ABD7357 100 ug
EUR 438

anti-LITAF

YF-PA16360 50 ug
EUR 363
Description: Mouse polyclonal to LITAF

anti-LITAF

YF-PA16361 100 ul
EUR 403
Description: Rabbit polyclonal to LITAF

anti-LITAF

YF-PA16362 100 ug
EUR 403
Description: Rabbit polyclonal to LITAF

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

LITAF Blocking Peptide

DF7357-BP 1mg
EUR 195

Polyclonal LITAF Antibody

APR17201G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LITAF . This antibody is tested and proven to work in the following applications:

LITAF Conjugated Antibody

C32869 100ul
EUR 397

LITAF cloning plasmid

CSB-CL859109HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 486
  • Sequence: ATGTCGGTTCCAGGACCTTACCAGGCGGCCACTGGGCCTTCCTCAGCACCATCCGCACCTCCATCCTATGAAGAGACAGTGGCTGTTAACAGTTATTACCCCACACCTCCAGCTCCCATGCCTGGGCCAACTACGGGGCTTGTGACGGGGCCTGATGGGAAGGGCATGAATCCTCC
  • Show more
Description: A cloning plasmid for the LITAF gene.

LITAF Polyclonal Antibody

ABP59126-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LITAF protein
  • Applications tips:
Description: A polyclonal antibody for detection of LITAF from Human, Mouse, Rat. This LITAF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LITAF protein

LITAF Polyclonal Antibody

ABP59126-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LITAF protein
  • Applications tips:
Description: A polyclonal antibody for detection of LITAF from Human, Mouse, Rat. This LITAF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LITAF protein

LITAF Polyclonal Antibody

ABP59126-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LITAF protein
  • Applications tips:
Description: A polyclonal antibody for detection of LITAF from Human, Mouse, Rat. This LITAF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LITAF protein

anti- LITAF antibody

FNab04798 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: lipopolysaccharide-induced TNF factor
  • Uniprot ID: Q99732
  • Gene ID: 9516
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against LITAF

LITAF Polyclonal Antibody

ES11138-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LITAF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

LITAF Polyclonal Antibody

ES11138-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LITAF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-LITAF antibody

PAab04798 100 ug
EUR 355

Anti-LITAF antibody

STJ27422 100 µl
EUR 277
Description: Lipopolysaccharide is a potent stimulator of monocytes and macrophages, causing secretion of tumor necrosis factor-alpha (TNF-alpha) and other inflammatory mediators. This gene encodes lipopolysaccharide-induced TNF-alpha factor, which is a DNA-binding protein and can mediate the TNF-alpha expression by direct binding to the promoter region of the TNF-alpha gene. The transcription of this gene is induced by tumor suppressor p53 and has been implicated in the p53-induced apoptotic pathway. Mutations in this gene cause Charcot-Marie-Tooth disease type 1C (CMT1C) and may be involved in the carcinogenesis of extramammary Paget's disease (EMPD). Multiple alternatively spliced transcript variants have been found for this gene.

Anti-LITAF antibody

STJ71339 100 µg
EUR 359

Anti-LITAF antibody

STJ192296 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LITAF

Anti-LITAF (2E12)

YF-MA16893 100 ug
EUR 363
Description: Mouse monoclonal to LITAF

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

LITAF protein (His tag)

80R-2650 100 ug
EUR 322
Description: Purified recombinant Human LITAF protein (His tag)

Human LITAF ELISA KIT

ELI-12371h 96 Tests
EUR 824

Mouse Litaf ELISA KIT

ELI-12372m 96 Tests
EUR 865

LITAF ELISA KIT|Human

EF010691 96 Tests
EUR 689

Chicken LITAF ELISA KIT

ELI-43561c 96 Tests
EUR 928

Mouse LITAF shRNA Plasmid

20-abx974878
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat LITAF shRNA Plasmid

20-abx986408
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LITAF shRNA Plasmid

20-abx956322
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LITAF Recombinant Protein (Human)

RP040795 100 ug Ask for price

LITAF Recombinant Protein (Rat)

RP208280 100 ug Ask for price

LITAF Recombinant Protein (Mouse)

RP147635 100 ug Ask for price

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent

1110-1ml
EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T

20-abx184099
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

EL Transfection Reagent

20-abx098880
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163

Biolipidure-1002-Reagent

Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent

FATRR-001 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 450ml
EUR 645

LP4K Transfection Reagent

LP4K 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent

LV750A-1 1 ml
EUR 359
  • Category: Lentiviral Technology

HighGene transfection reagent

RM09014 1000μl
EUR 270

TissueDigest Reagent, 20X

T101 10ml
EUR 210

ExFect2000 Transfection Reagent

T202-01 0.5 ml
EUR 227

ExFect2000 Transfection Reagent

T202-02 1 ml
EUR 316

ExFect2000 Transfection Reagent

T202-03 5 ml
EUR 1052

Dissociation Reagent, 1ML

X017-1ML 1ML
EUR 109

Dissociation Reagent, 25ML

X017-25ML 25ML
EUR 258

Dissociation Reagent, 5ML

X017-5ML 5ML
EUR 122

Dissociation Reagent, 1ML

X058-1ML 1ML
EUR 73

Dissociation Reagent, 5ML

X058-5ML 5ML
EUR 109

DTT (Cleland's reagent)

DB0058 5g
EUR 84.8
  • Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)

DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent

EC4600 1L
EUR 79
  • Product category: Biochemicals/Solvents

n-Heptane Reagent

HC5400 1L
EUR 79
  • Product category: Biochemicals/Solvents

Polyclonal LITAF Antibody (internal region)

APR17202G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LITAF (internal region). This antibody is tested and proven to work in the following applications:

[KO Validated] LITAF Rabbit pAb

A5469-100ul 100 ul
EUR 308

[KO Validated] LITAF Rabbit pAb

A5469-200ul 200 ul
EUR 459

[KO Validated] LITAF Rabbit pAb

A5469-20ul 20 ul
EUR 183

[KO Validated] LITAF Rabbit pAb

A5469-50ul 50 ul
EUR 223

Litaf ORF Vector (Rat) (pORF)

ORF069428 1.0 ug DNA
EUR 506

LITAF ORF Vector (Human) (pORF)

ORF013599 1.0 ug DNA
EUR 354

Litaf ORF Vector (Mouse) (pORF)

ORF049213 1.0 ug DNA
EUR 506

Anti-LITAF (KO validated) Antibody

A2075-100 100 µl
EUR 399

LITAF ELISA Kit (Mouse) (OKEH05545)

OKEH05545 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.88 pg/mL

LITAF ELISA Kit (Human) (OKEH05546)

OKEH05546 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.4 pg/mL

LITAF ELISA Kit (Rat) (OKEH06185)

OKEH06185 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL

LITAF ELISA Kit (Mouse) (OKEH06713)

OKEH06713 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

LITAF ELISA Kit (Rat) (OKEH06714)

OKEH06714 96 Wells
EUR 779
Description: Description of target: Probable role in regulating transcription of specific genes. May regulate through NFKB1 the expression of the CCL2/MCP-1 chemokine. May play a role in tumor necrosis factor alpha (TNF-alpha) gene expression;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

LITAF ELISA Kit (Chicken) (OKEH04620)

OKEH04620 96 Wells
EUR 844
Description: Description of target: Probable role in regulating transcription of specific genes.;Species reactivity: Chicken;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

Human Brain Tissue Lysate

30R-AB017 150 ug
EUR 273
Description: Fresh tissue lysate isolated from human brain

Chicken Liver Tissue Lysate

30R-AC011 150 ug
EUR 192
Description: Freshly prepared tissue lysate isolated from liver of normal chicken

Human Cerebellum Tissue Lysate

30R-AC058 150 ug
EUR 290
Description: Freshly prepared tissue lysate isolated from cerebellum of human brain

Human Hippocampus Tissue Lysate

30R-AH 150 ug
EUR 273
Description: Isolated Human Hippocampus Tissue Lysate

Human Heart Tissue Lysate

30R-AH049 150 ug
EUR 534
Description: Fresh tissue lysate isolated from human heart

Jurkat cell Lysate (untreated)

2401-100
EUR 185

Human Kidney Tissue Lysate

30R-AK003 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human kidney

Rabbit Liver Tissue Lysate

30R-AL003 150 ug
EUR 252
Description: Fresh tissue lysate prepared from rabbit liver

Human Lung Tissue Lysate

30R-AL006 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human lung

Human Midbrain Tissue Lysate

30R-AM011 150 ug
EUR 257
Description: Fresh tissue lysate isolated from the midbrain of human brain

Human Pancreas Tissue Lysate

30R-AP030 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human pancreas

Human Prostate Tissue Lysate

30R-AP031 150 ug
EUR 219
Description: Fresh tissue lysate prepared from normal human prostate

Human Pons Tissue Lysate

30R-AP033 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the pons of human brain

Human Posterior Cortex Lysate

30R-AP034 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the posterior cortex of human brain

Rat Retina Tissue Lysate

30R-AR005 150 ug
EUR 267
Description: Fresh tissue lysate prepared from the retina of rat eye

Human Striatum Tissue Lysate

30R-AS030 150 ug
EUR 327
Description: Fresh tissue lysate isolated from the striatum of human brain

Human Stomach Tissue Lysate

30R-AS039 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human stomach

Human Thalamus Tissue Lysate

30R-AT053 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the thalamus of human brain

JNK Activated Cell Lysate

7032-1
EUR 316

Akt Activated Cell Lysate

7036-1
EUR 316

BL21(DE3)-lysate Antibody

abx230903-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21(plysS) -lysate Antibody

abx230904-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Arbitrary or unconsidered transformation can result in flawed conclusions for the MVA cluster strategies, dimensionality discount strategies and classification strategies. We advocate transformation of circulation cytometry knowledge through the use of OTflow-defined parameters estimated per channel, so as to forestall peak-splitting and different artifacts within the knowledge. This text is protected by copyright. All rights reserved.

Leave a Reply

Your email address will not be published. Required fields are marked *